7FIH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7fih by Molmil](/molmil-images/mine/7fih) | luteinizing hormone/choriogonadotropin receptor(S277I)-chorionic gonadotropin-Gs-Org43553 complex | Descriptor: | 5-azanyl-N-tert-butyl-2-methylsulfanyl-4-[3-(2-morpholin-4-ylethanoylamino)phenyl]thieno[2,3-d]pyrimidine-6-carboxamide, Choriogonadotropin subunit beta 3, Engineered Guanine nucleotide-binding protein G(s) subunit alpha, ... | Authors: | Duan, J, Xu, P, Cheng, X, Mao, C, Croll, T, He, X, Shi, J, Luan, X, Yin, W, You, E, Liu, Q, Zhang, S, Jiang, H, Zhang, Y, Jiang, Y, Xu, H.E. | Deposit date: | 2021-07-31 | Release date: | 2021-09-29 | Last modified: | 2022-02-16 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Structures of full-length glycoprotein hormone receptor signalling complexes. Nature, 598, 2021
|
|
7FII
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7fii by Molmil](/molmil-images/mine/7fii) | luteinizing hormone/choriogonadotropin receptor-chorionic gonadotropin-Gs complex | Descriptor: | Choriogonadotropin subunit beta 3, Engineered Guanine nucleotide-binding protein G(s) subunit alpha, Glycoprotein hormones alpha chain, ... | Authors: | Duan, J, Xu, P, Cheng, X, Mao, C, Croll, T, He, X, Shi, J, Luan, X, Yin, W, You, E, Liu, Q, Zhang, S, Jiang, H, Zhang, Y, Jiang, Y, Xu, H.E. | Deposit date: | 2021-07-31 | Release date: | 2021-09-29 | Last modified: | 2022-02-16 | Method: | ELECTRON MICROSCOPY (4.3 Å) | Cite: | Structures of full-length glycoprotein hormone receptor signalling complexes. Nature, 598, 2021
|
|
7FIG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7fig by Molmil](/molmil-images/mine/7fig) | luteinizing hormone/choriogonadotropin receptor(S277I)-chorionic gonadotropin-Gs complex | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Camelid antibody VHH fragment Nb35, Choriogonadotropin subunit beta 3, ... | Authors: | Duan, J, Xu, P, Cheng, X, Mao, C, Croll, T, He, X, Shi, J, Luan, X, Yin, W, You, E, Liu, Q, Zhang, S, Jiang, H, Zhang, Y, Jiang, Y, Xu, H.E. | Deposit date: | 2021-07-31 | Release date: | 2021-09-29 | Last modified: | 2022-02-16 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Structures of full-length glycoprotein hormone receptor signalling complexes. Nature, 598, 2021
|
|
4ZCF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4zcf by Molmil](/molmil-images/mine/4zcf) | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|
5ABF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5abf by Molmil](/molmil-images/mine/5abf) | Structure of GH84 with ligand | Descriptor: | 1,2-ETHANEDIOL, 2-[(2S,3R,4R,5R)-5-(hydroxymethyl)-3,4-bis(oxidanyl)-1-pentyl-pyrrolidin-2-yl]-N-methyl-ethanamide, CALCIUM ION, ... | Authors: | Bergeron-Brlek, M, Goodwin-Tindall, J, Cekic, N, Varghese, V, Zandberg, W.F, Shan, X, Roth, C, Chan, S, Davies, G.J, Vocadlo, D.J, Britton, R. | Deposit date: | 2015-08-05 | Release date: | 2015-11-18 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | A Convenient Approach to Stereoisomeric Iminocyclitols: Generation of Potent Brain-Permeable Oga Inhibitors. Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
6G4A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6g4a by Molmil](/molmil-images/mine/6g4a) | FLN5 (full length) | Descriptor: | Gelation factor | Authors: | Waudby, C.A, Wlodarski, T, Karyadi, M.-E, Cassaignau, A.M.E, Chan, S.H.S, Wentink, A.S, Schmidt-Engler, J.M, Camilloni, C, Vendruscolo, M, Cabrita, L.D, Christodoulou, J. | Deposit date: | 2018-03-27 | Release date: | 2019-04-10 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Mapping energy landscapes of a growing filamin domain reveals an intermediate associated with proline isomerization during biosynthesis To Be Published
|
|
6M2L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6m2l by Molmil](/molmil-images/mine/6m2l) | Crystal structure of Plasmodium falciparum hexose transporter PfHT1 bound with C3361 | Descriptor: | (2S,3R,4S,5R,6R)-6-(hydroxymethyl)-4-undec-10-enoxy-oxane-2,3,5-triol, Hexose transporter 1 | Authors: | Jiang, X, Yuan, Y.Y, Zhang, S, Wang, N, Yan, C.Y, Yan, N. | Deposit date: | 2020-02-27 | Release date: | 2020-09-09 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.7 Å) | Cite: | Structural Basis for Blocking Sugar Uptake into the Malaria Parasite Plasmodium falciparum. Cell, 183, 2020
|
|
6C4Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6c4y by Molmil](/molmil-images/mine/6c4y) | Cross-alpha Amyloid-like Structure alphaAmG | Descriptor: | Cross-alpha Amyloid-like Structure alphaAmG | Authors: | Liu, L, Zhang, S.Q. | Deposit date: | 2018-01-13 | Release date: | 2018-08-15 | Last modified: | 2019-12-18 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Designed peptides that assemble into cross-alpha amyloid-like structures. Nat. Chem. Biol., 14, 2018
|
|
4ZKT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4zkt by Molmil](/molmil-images/mine/4zkt) | |
5IXM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ixm by Molmil](/molmil-images/mine/5ixm) | The LPS Transporter LptDE from Yersinia pestis, core complex | Descriptor: | (HYDROXYETHYLOXY)TRI(ETHYLOXY)OCTANE, LPS-assembly lipoprotein LptE, LPS-assembly protein LptD | Authors: | Botos, I, Mayclin, S.J, McCarthy, J.G, Buchanan, S.K. | Deposit date: | 2016-03-23 | Release date: | 2016-05-18 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.746 Å) | Cite: | Structural and Functional Characterization of the LPS Transporter LptDE from Gram-Negative Pathogens. Structure, 24, 2016
|
|
7CN8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7cn8 by Molmil](/molmil-images/mine/7cn8) | Cryo-EM structure of PCoV_GX spike glycoprotein | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Glycoprotein, ... | Authors: | Wang, X, Yu, J, Zhang, S, Qiao, S, Zeng, J, Tian, L. | Deposit date: | 2020-07-30 | Release date: | 2021-03-03 | Last modified: | 2021-03-24 | Method: | ELECTRON MICROSCOPY (2.5 Å) | Cite: | Bat and pangolin coronavirus spike glycoprotein structures provide insights into SARS-CoV-2 evolution. Nat Commun, 12, 2021
|
|
4ZJM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4zjm by Molmil](/molmil-images/mine/4zjm) | Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763) | Descriptor: | CHLORIDE ION, GLYCEROL, Lipoprotein LpqH, ... | Authors: | Arbing, M.A, Chan, S, Kuo, E, Harris, L.R, Zhou, T.T, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2015-04-29 | Release date: | 2015-05-13 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763) To Be Published
|
|
7CN4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7cn4 by Molmil](/molmil-images/mine/7cn4) | Cryo-EM structure of bat RaTG13 spike glycoprotein | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Spike glycoprotein | Authors: | Wang, X, Zhang, S, Qiao, S, Yu, J, Zeng, J, Tian, L. | Deposit date: | 2020-07-30 | Release date: | 2021-03-03 | Last modified: | 2021-03-24 | Method: | ELECTRON MICROSCOPY (2.93 Å) | Cite: | Bat and pangolin coronavirus spike glycoprotein structures provide insights into SARS-CoV-2 evolution. Nat Commun, 12, 2021
|
|
4UPB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4upb by Molmil](/molmil-images/mine/4upb) | Electron cryo-microscopy of the complex formed between the hexameric ATPase RavA and the decameric inducible decarboxylase LdcI | Descriptor: | ATPASE RAVA, LYSINE DECARBOXYLASE, INDUCIBLE | Authors: | Malet, H, Liu, K, El Bakkouri, M, Chan, S.W.S, Effantin, G, Bacia, M, Houry, W.A, Gutsche, I. | Deposit date: | 2014-06-15 | Release date: | 2014-08-20 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (11 Å) | Cite: | Assembly Principles of a Unique Cage Formed by Hexameric and Decameric E. Coli Proteins. Elife, 3, 2014
|
|
1SMF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1smf by Molmil](/molmil-images/mine/1smf) | Studies on an artificial trypsin inhibitor peptide derived from the mung bean inhibitor | Descriptor: | BOWMAN-BIRK TYPE TRYPSIN INHIBITOR, CALCIUM ION, TRYPSIN | Authors: | Huang, Q, Li, Y, Zhang, S, Liu, S, Tang, Y, Qi, C. | Deposit date: | 1992-10-24 | Release date: | 1994-07-31 | Last modified: | 2017-06-28 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Studies on an artificial trypsin inhibitor peptide derived from the mung bean trypsin inhibitor: chemical synthesis, refolding, and crystallographic analysis of its complex with trypsin. J.Biochem.(Tokyo), 116, 1994
|
|
6WIM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6wim by Molmil](/molmil-images/mine/6wim) | CdiB from Escherichia coli | Descriptor: | 1,2-ETHANEDIOL, DI(HYDROXYETHYL)ETHER, Outer membrane transporter CdiB | Authors: | Guerin, J, Botos, I, Buchanan, S.K. | Deposit date: | 2020-04-10 | Release date: | 2020-11-04 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural insight into toxin secretion by contact dependent growth inhibition transporters. Elife, 9, 2020
|
|
3L47
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3l47 by Molmil](/molmil-images/mine/3l47) | |
3L4L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3l4l by Molmil](/molmil-images/mine/3l4l) | |
4UPF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4upf by Molmil](/molmil-images/mine/4upf) | Assembly principles of the unique cage formed by the ATPase RavA hexamer and the lysine decarboxylase LdcI decamer | Descriptor: | ATPASE RAVA, LYSINE DECARBOXYLASE, INDUCIBLE | Authors: | Malet, H, Liu, K, El Bakkouri, M, Chan, S.W.S, Effantin, G, Bacia, M, Houry, W.A, Gutsche, I. | Deposit date: | 2014-06-16 | Release date: | 2014-08-20 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (7.5 Å) | Cite: | Assembly Principles of a Unique Cage Formed by Hexameric and Decameric E. Coli Proteins. Elife, 3, 2014
|
|
8OV5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8ov5 by Molmil](/molmil-images/mine/8ov5) | |
7FCD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7fcd by Molmil](/molmil-images/mine/7fcd) | Structure of the SARS-CoV-2 A372T spike glycoprotein (open) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Spike glycoprotein | Authors: | Wang, X, Zhang, S. | Deposit date: | 2021-07-14 | Release date: | 2022-01-26 | Last modified: | 2022-03-16 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Loss of Spike N370 glycosylation as an important evolutionary event for the enhanced infectivity of SARS-CoV-2. Cell Res., 32, 2022
|
|
3QME
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3qme by Molmil](/molmil-images/mine/3qme) | |
6KCF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6kcf by Molmil](/molmil-images/mine/6kcf) | |
6GN4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6gn4 by Molmil](/molmil-images/mine/6gn4) | tc-DNA/tc-DNA duplex | Descriptor: | Tc-DNA (5'-D(*(TCJ)P*(TTK)P*(TCJ)P*(TCS)P*(TCS)P*(TCJ)P*(TTK)P*(TTK)P*(TCY)P*(TCJ))-3'), Tc-DNA (5'-D(*(TCS)P*(TTK)P*(TCY)P*(TCY)P*(TCS)P*(TCJ)P*(TCJ)P*(TCS)P*(TCY)P*(TCS))-3') | Authors: | Istrate, A, Johannsen, S, Istrate, A, Sigel, R.K.O, Leumann, C. | Deposit date: | 2018-05-29 | Release date: | 2018-06-06 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | NMR solution structure of tricyclo-DNA containing duplexes: insight into enhanced thermal stability and nuclease resistance. Nucleic Acids Res., 47, 2019
|
|
7FJS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7fjs by Molmil](/molmil-images/mine/7fjs) | Crystal structure of T6 Fab bound to theSARS-CoV-2 RBD of B.1.351 | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Spike protein S1, T6 heavy chain, ... | Authors: | Wang, X, Zhang, L, Zhang, S, Liang, Q. | Deposit date: | 2021-08-04 | Release date: | 2022-04-27 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | RBD trimer mRNA vaccine elicits broad and protective immune responses against SARS-CoV-2 variants. Iscience, 25, 2022
|
|