1IJY
 
 | | CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) | | Descriptor: | FRIZZLED HOMOLOG 8 | | Authors: | Dann III, C.E, Hsieh, J.C, Rattner, A, Sharma, D, Nathans, J, Leahy, D.J. | | Deposit date: | 2001-05-01 | | Release date: | 2001-07-11 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.35 Å) | | Cite: | Insights into Wnt binding and signalling from the structures of two Frizzled cysteine-rich domains.
Nature, 412, 2001
|
|
7TCE
 | | Crystal structure of delta sub IV Rhodobacter Sphaeroides bc1 with the antimalarial drug atovaquone. | | Descriptor: | 1,2-DIHEXANOYL-SN-GLYCERO-3-PHOSPHOETHANOLAMINE, 2-[trans-4-(4-chlorophenyl)cyclohexyl]-3-hydroxynaphthalene-1,4-dione, Cytochrome b, ... | | Authors: | Esser, L, Xia, D, Zhou, F. | | Deposit date: | 2021-12-23 | | Release date: | 2023-01-18 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (3.85 Å) | | Cite: | Crystal structure of delta sub IV Rhodobacter Sphaeroides bc1 with the antimalarial drug atovaquone.
To Be Published
|
|
4E0M
 | | SVQIVYK segment from human Tau (305-311) displayed on 54-membered macrocycle scaffold (form I) | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Cyclic pseudo-peptide SVQIVYK(ORN)EF(HAO)(4BF)K(ORN), PHOSPHATE ION | | Authors: | Zhao, M, Liu, C, Michael, S.R, Eisenberg, D. | | Deposit date: | 2012-03-04 | | Release date: | 2013-02-13 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Out-of-register beta-sheets suggest a pathway
to toxic amyloid aggregates
Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
7T9C
 | | Crystal structure of dehaloperoxidase B in complex with thymol | | Descriptor: | 5-METHYL-2-(1-METHYLETHYL)PHENOL, Dehaloperoxidase B, GLYCEROL, ... | | Authors: | de Serrano, V.S, Ghiladi, R.A, Malewschik, T, Yun, D. | | Deposit date: | 2021-12-18 | | Release date: | 2023-01-25 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (1.73 Å) | | Cite: | The Multifunctional Globin Dehaloperoxidase as a Biocatalyst in the Oxidation of Monoterpenes
To Be Published
|
|
7T9E
 | | Crystal structure of dehaloperoxidase B in complex with +(-)-limonene oxide | | Descriptor: | (1R,4R,6S)-1-methyl-4-(prop-1-en-2-yl)-7-oxabicyclo[4.1.0]heptane, Dehaloperoxidase B, GLYCEROL, ... | | Authors: | de Serrano, V.S, Ghiladi, R.A, Malewschik, T, Yun, D. | | Deposit date: | 2021-12-18 | | Release date: | 2023-01-25 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (1.57 Å) | | Cite: | The Multifunctional Globin Dehaloperoxidase as a Biocatalyst in the Oxidation of Monoterpenes
To Be Published
|
|
7T9D
 | | Crystal structure of dehaloperoxidase B in complex with -(-) limonene oxide | | Descriptor: | (1S,4S,6R)-1-methyl-4-(prop-1-en-2-yl)-7-oxabicyclo[4.1.0]heptane, Dehaloperoxidase B, GLYCEROL, ... | | Authors: | de Serran, V.S, Ghiladi, R.A, Malewschik, T, Yun, D. | | Deposit date: | 2021-12-18 | | Release date: | 2023-01-25 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (1.66 Å) | | Cite: | The Multifunctional Globin Dehaloperoxidase as a Biocatalyst in the Oxidation of Monoterpenes
To Be Published
|
|
1J3G
 | | Solution structure of Citrobacter Freundii AmpD | | Descriptor: | AmpD protein, ZINC ION | | Authors: | Liepinsh, E, Genereux, C, Dehareng, D, Joris, B, Otting, G. | | Deposit date: | 2003-01-31 | | Release date: | 2003-02-18 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | NMR Structure of Citrobacter freundii AmpD, Comparison with Bacteriophage T7 Lysozyme
and Homology with PGRP Domains
J.Mol.Biol., 327, 2003
|
|
5EA8
 | | Crystal Structure of Prefusion RSV F Glycoprotein Fusion Inhibitor Resistance Mutant D489Y | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, D(-)-TARTARIC ACID, Fusion glycoprotein F0, ... | | Authors: | Battles, M.B, McLellan, J.S, Arnoult, E, Roymans, D, Langedijk, J.P. | | Deposit date: | 2015-10-15 | | Release date: | 2015-12-09 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Molecular mechanism of respiratory syncytial virus fusion inhibitors.
Nat.Chem.Biol., 12, 2016
|
|
5DTO
 | | Dengue virus full length NS5 complexed with viral Cap 0-RNA and SAH | | Descriptor: | 7N-METHYL-8-HYDROGUANOSINE-5'-DIPHOSPHATE, ACETATE ION, MAGNESIUM ION, ... | | Authors: | Zhao, Y, Soh, T.S, Lim, S.P, Chung, K.Y, Swaminathan, K, Vasudevan, S.G, Shi, P.-Y, Lescar, J, Luo, D. | | Deposit date: | 2015-09-18 | | Release date: | 2015-11-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.603 Å) | | Cite: | Molecular basis for specific viral RNA recognition and 2'-O-ribose methylation by the dengue virus nonstructural protein 5 (NS5)
Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
4E0L
 | | FYLLYYT segment from human Beta 2 Microglobulin (62-68) displayed on 54-membered macrocycle scaffold | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Cyclic pseudo-peptide FYLLYYT(ORN)KN(HAO)SA(ORN) | | Authors: | Zhao, M, Liu, C, Michael, S.R, Eisenberg, D. | | Deposit date: | 2012-03-04 | | Release date: | 2012-12-19 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates.
Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
5DQK
 | | Two divalent metal ions and conformational changes play roles in the hammerhead ribozyme cleavage reaction-WT ribozyme in Mg2+ | | Descriptor: | MAGNESIUM ION, POTASSIUM ION, RNA (48-MER), ... | | Authors: | Mir, A, Chen, J, Neau, D, Golden, B.L. | | Deposit date: | 2015-09-14 | | Release date: | 2015-10-07 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.707 Å) | | Cite: | Two Divalent Metal Ions and Conformational Changes Play Roles in the Hammerhead Ribozyme Cleavage Reaction.
Biochemistry, 54, 2015
|
|
7TA8
 | | NMR structure of crosslinked cyclophilin A | | Descriptor: | Peptidyl-prolyl cis-trans isomerase A | | Authors: | Lu, M, Toptygin, D, Xiang, Y, Shi, Y, Schwieters, C.D, Lipinski, E.C, Ahn, J, Byeon, I.-J.L, Gronenborn, A.M. | | Deposit date: | 2021-12-20 | | Release date: | 2022-06-01 | | Last modified: | 2023-06-14 | | Method: | SOLUTION NMR | | Cite: | The Magic of Linking Rings: Discovery of a Unique Photoinduced Fluorescent Protein Crosslink.
J.Am.Chem.Soc., 144, 2022
|
|
5DXU
 | | p110delta/p85alpha with GDC-0326 | | Descriptor: | (2S)-2-({2-[1-(propan-2-yl)-1H-1,2,4-triazol-5-yl]-5,6-dihydroimidazo[1,2-d][1,4]benzoxazepin-9-yl}oxy)propanamide, Phosphatidylinositol 3-kinase regulatory subunit alpha, Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform | | Authors: | Heffron, T.P, Heald, R.A, Ndubaku, C, Wei, B.Q, Augustin, M, Do, S, Edgar, K, Eigenbrot, C, Friedman, L, Gancia, E, Jackson, P.S, Jones, G, Kolesnikov, A, Lee, L.B, Lesnick, J.D, Lewis, C, McLean, N, Mortle, M, Nonomiya, J, Pang, J, Price, S, Prior, W.W, Salphati, L, Sideris, S, Staben, S.T, Steinbacher, S, Tsui, V, Wallin, J, Sampath, D, Olivero, A. | | Deposit date: | 2015-09-23 | | Release date: | 2016-01-27 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.64 Å) | | Cite: | The Rational Design of Selective Benzoxazepin Inhibitors of the alpha-Isoform of Phosphoinositide 3-Kinase Culminating in the Identification of (S)-2-((2-(1-Isopropyl-1H-1,2,4-triazol-5-yl)-5,6-dihydrobenzo[f]imidazo[1,2-d][1,4]oxazepin-9-yl)oxy)propanamide (GDC-0326).
J.Med.Chem., 59, 2016
|
|
5DSD
 | | The crystal structure of the C-terminal domain of Ebola (Bundibugyo) nucleoprotein | | Descriptor: | CHLORIDE ION, GLYCEROL, Nucleoprotein | | Authors: | Baker, L, Handing, K.B, Utepbergenov, D, Derewenda, U, Derewenda, Z.S. | | Deposit date: | 2015-09-17 | | Release date: | 2015-09-30 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Molecular architecture of the nucleoprotein C-terminal domain from the Ebola and Marburg viruses.
Acta Crystallogr D Struct Biol, 72, 2016
|
|
1IY0
 | | Crystal structure of the FtsH ATPase domain with AMP-PNP from Thermus thermophilus | | Descriptor: | ATP-dependent metalloprotease FtsH, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Niwa, H, Tsuchiya, D, Makyio, H, Yoshida, M, Morikawa, K. | | Deposit date: | 2002-07-10 | | Release date: | 2002-11-06 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.95 Å) | | Cite: | Hexameric ring structure of the ATPase domain of the membrane-integrated metalloprotease FtsH from Thermus thermophilus HB8
Structure, 10, 2002
|
|
5E03
 | | Crystal structure of mouse CTLA-4 nanobody | | Descriptor: | CTLA-4 nanobody, SULFATE ION | | Authors: | Fedorov, A.A, Fedorov, E.V, Samanta, D, Bonanno, J.B, Almo, S.C. | | Deposit date: | 2015-09-28 | | Release date: | 2015-10-07 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.685 Å) | | Cite: | Crystal structure of mouse CTLA-4 nanobody
To Be Published
|
|
5E0A
 | | Crystal Structure of the complex of Camel Peptidoglycan Recognition Protein (CPGRP-S) and N-Acetylglucosamine at 2.6 A | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, L(+)-TARTARIC ACID, Peptidoglycan recognition protein 1 | | Authors: | Dube, D, Sharma, P, Sinha, M, Kaur, P, Sharma, S, Singh, T.P. | | Deposit date: | 2015-09-28 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal Structure of the complex of Camel Peptidoglycan Recognition Protein (CPGRP-S) and N-Acetylglucosamine at 2.6 A
To Be Published
|
|
5E61
 | |
5DXH
 | | p110alpha/p85alpha with compound 5 | | Descriptor: | Phosphatidylinositol 3-kinase regulatory subunit alpha, Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform, methyl {2-[4-(2-chlorophenyl)-4H-1,2,4-triazol-3-yl]-4,5-dihydrothieno[3,2-d][1]benzoxepin-8-yl}carbamate | | Authors: | Heffron, T.P, Heald, R.A, Ndubaku, C, Wei, B.Q, Augustin, M, Do, S, Edgar, K, Eigenbrot, C, Friedman, L, Gancia, E, Jackson, P.S, Jones, G, Kolesnikov, A, Lee, L.B, Lesnick, J.D, Lewis, C, McLean, N, Mortle, M, Nonomiya, J, Pang, J, Price, S, Prior, W.W, Salphati, L, Sideris, S, Staben, S, Steinbacher, S, Tsui, V, Wallin, J, Sampath, D, Olivero, A. | | Deposit date: | 2015-09-23 | | Release date: | 2016-01-27 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Rational Design of Selective Benzoxazepin Inhibitors of the alpha-Isoform of Phosphoinositide 3-Kinase Culminating in the Identification of (S)-2-((2-(1-Isopropyl-1H-1,2,4-triazol-5-yl)-5,6-dihydrobenzo[f]imidazo[1,2-d][1,4]oxazepin-9-yl)oxy)propanamide (GDC-0326).
J.Med.Chem., 59, 2016
|
|
5EAL
 | | Crystal structure of human WDR5 in complex with compound 9h | | Descriptor: | 1,2-ETHANEDIOL, 3-methyl-~{N}-[2-(4-methylpiperazin-1-yl)-5-quinolin-3-yl-phenyl]benzamide, CHLORIDE ION, ... | | Authors: | DONG, A, DOMBROVSKI, L, SMIL, D, GETLIK, M, BOLSHAN, Y, WALKER, J.R, SENISTERRA, G, PODA, G, AL-AWAR, R, SCHAPIRA, M, VEDADI, M, Bountra, C, Edwards, A.M, Arrowsmith, C.H, BROWN, P.J, WU, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-10-16 | | Release date: | 2015-11-04 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structure of human WDR5 in complex with compound 9h
to be published
|
|
5EC0
 | | Crystal Structure of Actin-like protein Alp7A | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Alp7A, GLYCEROL, ... | | Authors: | Petek, N.A, Kraemer, J.A, Mullins, R.D, Agard, D.A, DiMaio, F, Baker, D. | | Deposit date: | 2015-10-20 | | Release date: | 2016-11-02 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and function of Alp7A reveal both conserved and unique features of plasmid segregation.
To Be Published
|
|
7THI
 | | Human Bisphosphoglycerate Mutase complexed with 2-phosphoglycolate | | Descriptor: | 2-PHOSPHOGLYCOLIC ACID, Bisphosphoglycerate mutase | | Authors: | Clark, K.L, Kulathila, R, Wright, K, Isome, Y, Sage, D, Yang, Y, Christodoulou, C. | | Deposit date: | 2022-01-11 | | Release date: | 2022-01-26 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.33 Å) | | Cite: | Human Bisphosphoglycerate Mutase complexed with 2-phosphoglycolate
To Be Published
|
|
1OEO
 | | PTP1B with the catalytic cysteine oxidized to sulfonic acid | | Descriptor: | PROTEIN-TYROSINE PHOSPHATASE, NON-RECEPTOR TYPE 1 | | Authors: | Salmeen, A, Andersen, J.N, Myers, M.P, Meng, T.C, Hinks, J.A, Tonks, N.K, Barford, D. | | Deposit date: | 2003-03-28 | | Release date: | 2003-06-12 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Redox Regulation of Protein Tyrosine Phosphatase Involves a Sulfenyl-Amide Intermediate
Nature, 423, 2003
|
|
1IXR
 | | RuvA-RuvB complex | | Descriptor: | Holliday junction DNA helicase ruvA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, RuvB | | Authors: | Yamada, K, Miyata, T, Tsuchiya, D, Oyama, T, Fujiwara, Y, Ohnishi, T, Iwasaki, H, Shinagawa, H, Ariyoshi, M, Mayanagi, K, Morikawa, K. | | Deposit date: | 2002-07-04 | | Release date: | 2002-11-06 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Crystal Structure of the RuvA-RuvB Complex: A Structural Basis for the Holliday Junction Migrating Motor Machinery
Mol.Cell, 10, 2002
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
