1DYT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1dyt by Molmil](/molmil-images/mine/1dyt) | X-ray crystal structure of ECP (RNase 3) at 1.75 A | Descriptor: | CITRIC ACID, EOSINOPHIL CATIONIC PROTEIN, FE (III) ION | Authors: | Mallorqui-Fernandez, G, Pous, J, Peracaula, R, Maeda, T, Tada, H, Yamada, H, Seno, M, De Llorens, R, Gomis-Rueth, F.X, Coll, M. | Deposit date: | 2000-02-08 | Release date: | 2001-02-08 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Three-Dimensional Crystal Structure of Human Eosinophil Cationic Protein (Rnase 3) at 1.75 A Resolution. J.Mol.Biol., 300, 2000
|
|
3BB7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3bb7 by Molmil](/molmil-images/mine/3bb7) | Structure of Prevotella intermedia prointerpain A fragment 39-359 (mutant C154A) | Descriptor: | interpain A | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2007-11-09 | Release date: | 2007-11-20 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A J.Biol.Chem., 283, 2008
|
|
3BBA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3bba by Molmil](/molmil-images/mine/3bba) | Structure of active wild-type Prevotella intermedia interpain A cysteine protease | Descriptor: | interpain A | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2007-11-09 | Release date: | 2007-11-20 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A J.Biol.Chem., 283, 2008
|
|
1SAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sax by Molmil](/molmil-images/mine/1sax) | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
1OKR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1okr by Molmil](/molmil-images/mine/1okr) | Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2003-07-28 | Release date: | 2003-10-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance J.Biol.Chem., 278, 2003
|
|
1E21
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1e21 by Molmil](/molmil-images/mine/1e21) | Ribonuclease 1 des1-7 Crystal Structure at 1.9A | Descriptor: | RIBONUCLEASE 1 | Authors: | Pous, J, Mallorqui-Fernandez, G, Peracaula, R, Terzyan, S.S, Futami, J, Tada, H, Yamada, H, Seno, M, De Llorens, R, Gomis-Ruth, F.X, Coll, M. | Deposit date: | 2000-05-15 | Release date: | 2001-05-03 | Last modified: | 2023-12-06 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Three-Dimensional Crystal Structure of Human Rnase 1Dn7 at 1.9A Resolution Acta Crystallogr.,Sect.D, 57, 2001
|
|
2IWC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2iwc by Molmil](/molmil-images/mine/2iwc) | Benzylpenicilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | Descriptor: | METHICILLIN RESISTANCE MECR1 PROTEIN, OPEN FORM - PENICILLIN G | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|
2IWD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2iwd by Molmil](/molmil-images/mine/2iwd) | Oxacilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | Descriptor: | (2R,4S)-5,5-dimethyl-2-[(1R)-1-{[(5-methyl-3-phenyl-1,2-oxazol-4-yl)carbonyl]amino}-2-oxoethyl]-1,3-thiazolidine-4-carb oxylic acid, Methicillin resistance mecR1 protein | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-03 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|
2IWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2iwb by Molmil](/molmil-images/mine/2iwb) | MecR1 unbound extracellular antibiotic-sensor domain. | Descriptor: | GLYCEROL, METHICILLIN RESISTANCE MECR1 PROTEIN, NICKEL (II) ION, ... | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|
4X08
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4x08 by Molmil](/molmil-images/mine/4x08) | Structure of H128N/ECP mutant in complex with sulphate anions at 1.34 Angstroms. | Descriptor: | Eosinophil cationic protein, SULFATE ION | Authors: | Blanco, J.A, Garcia, J.M, Salazar, V.A, Sanchez, D, Moussauoi, M, Boix, E. | Deposit date: | 2014-11-21 | Release date: | 2015-10-07 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.34 Å) | Cite: | Structure of H128N/ECP mutant in complex with sulphate anions at 1.34 Angstroms. To Be Published
|
|
4OXF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4oxf by Molmil](/molmil-images/mine/4oxf) | |