1DNE
 
 | | MOLECULAR STRUCTURE OF THE NETROPSIN-D(CGCGATATCGCG) COMPLEX: DNA CONFORMATION IN AN ALTERNATING AT SEGMENT; CONFORMATION 2 | | Descriptor: | DNA (5'-D(*CP*GP*CP*GP*AP*TP*AP*TP*CP*GP*CP*G)-3'), NETROPSIN | | Authors: | Coll, M, Aymami, J, Van Der Marel, G.A, Van Boom, J.H, Rich, A, Wang, A.H.-J. | | Deposit date: | 1988-09-14 | | Release date: | 1989-01-09 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Molecular structure of the netropsin-d(CGCGATATCGCG) complex: DNA conformation in an alternating AT segment.
Biochemistry, 28, 1989
|
|
1DNF
 | | EFFECTS OF 5-FLUOROURACIL/GUANINE WOBBLE BASE PAIRS IN Z-DNA. MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGFG) | | Descriptor: | DNA (5'-D(*CP*GP*CP*GP*(UFP)P*G)-3'), MAGNESIUM ION | | Authors: | Coll, M, Saal, D, Frederick, C.A, Aymami, J, Rich, A, Wang, A.H.-J. | | Deposit date: | 1988-12-12 | | Release date: | 1990-10-15 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Effects of 5-fluorouracil/guanine wobble base pairs in Z-DNA: molecular and crystal structure of d(CGCGFG).
Nucleic Acids Res., 17, 1989
|
|
1VTJ
 | | MOLECULAR STRUCTURE OF THE NETROPSIN-D(CGCGATATCGCG) COMPLEX: DNA CONFORMATION IN AN ALTERNATING AT SEGMENT; CONFORMATION 1 | | Descriptor: | DNA (5'-D(*CP*GP*CP*GP*AP*TP*AP*TP*CP*GP*CP*G)-3'), NETROPSIN | | Authors: | Coll, M, Aymami, J, Van Der Marel, G.A, Van Boom, J.H, Rich, A, Wang, A.H.-J. | | Deposit date: | 1999-09-14 | | Release date: | 2011-07-13 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Molecular Structure of the Netropsin-d(CGCGATATCGCG) Complex: DNA Conformation in an Alternating AT Segment
Biochemistry, 28, 1989
|
|
1VTY
 | | Crystal structure of a Z-DNA fragment containing thymine/2-aminoadenine base pairs | | Descriptor: | AMINO GROUP, DNA (5'-D(*CP*(NH2)AP*CP*GP*TP*G)-3'), MAGNESIUM ION | | Authors: | Coll, M, Wang, A.H.-J, Van Der Marel, G.A, Van Boom, J.H, Rich, A. | | Deposit date: | 1988-08-18 | | Release date: | 2011-07-13 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Crystal structure of a Z-DNA fragment containing thymine/2-aminoadenine base pairs.
J. Biomol. Struct. Dyn., 4, 1986
|
|
2DND
 | | A BIFURCATED HYDROGEN-BONDED CONFORMATION IN THE D(A.T) BASE PAIRS OF THE DNA DODECAMER D(CGCAAATTTGCG) AND ITS COMPLEX WITH DISTAMYCIN | | Descriptor: | DISTAMYCIN A, DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)-3') | | Authors: | Coll, M, Frederick, C.A, Wang, A.H.-J, Rich, A. | | Deposit date: | 1988-08-29 | | Release date: | 1989-01-09 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | A bifurcated hydrogen-bonded conformation in the d(A.T) base pairs of the DNA dodecamer d(CGCAAATTTGCG) and its complex with distamycin.
Proc.Natl.Acad.Sci.USA, 84, 1987
|
|
1H6F
 | | Human TBX3, a transcription factor responsible for ulnar-mammary syndrome, bound to a palindromic DNA site | | Descriptor: | 5'-D(*TP*AP*AP*TP*TP*TP*CP*AP*CP*AP*CP*CP*TP* AP*GP*GP*TP*GP*TP*GP*AP*AP*AP*T)-3', MAGNESIUM ION, T-BOX TRANSCRIPTION FACTOR TBX3 | | Authors: | Coll, M, Muller, C.W. | | Deposit date: | 2001-06-13 | | Release date: | 2002-04-19 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structure of the DNA-Bound T-Box Domain of Human Tbx3, a Transcription Factor Responsible for Ulnar- Mammary Syndrome
Structure, 10, 2002
|
|
3T72
 | | PhoB(E)-Sigma70(4)-(RNAP-Betha-flap-tip-helix)-DNA Transcription Activation Sub-Complex | | Descriptor: | PHO BOX DNA (STRAND 1), PHO BOX DNA (STRAND 2), Phosphate regulon transcriptional regulatory protein phoB, ... | | Authors: | Blanco, A.G, Canals, A, Bernues, J, Sola, M, Coll, M. | | Deposit date: | 2011-07-29 | | Release date: | 2011-09-21 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (4.33 Å) | | Cite: | The structure of a transcription activation subcomplex reveals how sigma (70) is recruited to PhoB promoters.
Embo J., 30, 2011
|
|
6QWP
 | | Crystal structure of T7 bacteriophage portal protein, 13mer, closed valve | | Descriptor: | Portal protein | | Authors: | Fabrega-Ferrer, M, Cuervo, A, Machon, C, Fernandez, F.J, Perez-Luque, R, Pous, J, Vega, M.C, Carrascosa, J.L, Coll, M. | | Deposit date: | 2019-03-06 | | Release date: | 2019-09-04 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (3.4 Å) | | Cite: | Structures of T7 bacteriophage portal and tail suggest a viral DNA retention and ejection mechanism.
Nat Commun, 10, 2019
|
|
6QXM
 | | Cryo-EM structure of T7 bacteriophage portal protein, 12mer, open valve | | Descriptor: | Portal protein | | Authors: | Fabrega-Ferrer, M, Cuervo, A, Machon, C, Fernandez, F.J, Perez-Luque, R, Pous, J, Vega, M.C, Carrascosa, J.L, Coll, M. | | Deposit date: | 2019-03-07 | | Release date: | 2019-09-04 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structures of T7 bacteriophage portal and tail suggest a viral DNA retention and ejection mechanism.
Nat Commun, 10, 2019
|
|
4D7A
 | | Crystal structure of E. coli tRNA N6-threonylcarbamoyladenosine dehydratase, TcdA, in complex with AMP at 1.801 Angstroem resolution | | Descriptor: | ADENOSINE MONOPHOSPHATE, GLYCEROL, PHOSPHATE ION, ... | | Authors: | Lopez-Estepa, M, Arda, A, Savko, M, Round, A, Shepard, W, Bruix, M, Coll, M, Fernandez, F.J, Jimenez-Barbero, J, Vega, M.C. | | Deposit date: | 2014-11-21 | | Release date: | 2015-05-06 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.801 Å) | | Cite: | The Crystal Structure and Small-Angle X-Ray Analysis of Csdl/Tcda Reveal a New tRNA Binding Motif in the Moeb/E1 Superfamily.
Plos One, 10, 2015
|
|
4D79
 | | Crystal structure of E. coli tRNA N6-threonylcarbamoyladenosine dehydratase, TcdA, in complex with ATP at 1.768 Angstroem resolution | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, GLYCEROL, POTASSIUM ION, ... | | Authors: | Lopez-Estepa, M, Arda, A, Savko, M, Round, A, Shepard, W, Bruix, M, Coll, M, Fernandez, F.J, Jimenez-Barbero, J, Vega, M.C. | | Deposit date: | 2014-11-21 | | Release date: | 2015-05-06 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.768 Å) | | Cite: | The Crystal Structure and Small-Angle X-Ray Analysis of Csdl/Tcda Reveal a New tRNA Binding Motif in the Moeb/E1 Superfamily.
Plos One, 10, 2015
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
1S6M
 | | Conjugative Relaxase Trwc In Complex With Orit DNA. Metal-Bound Structure | | Descriptor: | DNA (25-MER), NICKEL (II) ION, TrwC | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2004-01-26 | | Release date: | 2005-06-14 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.28 Å) | | Cite: | Unveiling the molecular mechanism of a conjugative relaxase: The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site.
J.Mol.Biol., 358, 2006
|
|
4CVQ
 | | CRYSTAL STRUCTURE OF AN AMINOTRANSFERASE FROM ESCHERICHIA COLI AT 2. 11 ANGSTROEM RESOLUTION | | Descriptor: | ACETATE ION, GLUTAMATE-PYRUVATE AMINOTRANSFERASE ALAA, GLYCEROL, ... | | Authors: | Penya-Soler, E, Fernandez, F.J, Lopez-Estepa, M, Garces, F, Richardson, A.J, Rudd, K.E, Coll, M, Vega, M.C. | | Deposit date: | 2014-03-28 | | Release date: | 2014-07-23 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.11 Å) | | Cite: | Structural analysis and mutant growth properties reveal distinctive enzymatic and cellular roles for the three major L-alanine transaminases of Escherichia coli.
PLoS ONE, 9, 2014
|
|
1RNF
 | | X-RAY CRYSTAL STRUCTURE OF UNLIGANDED HUMAN RIBONUCLEASE 4 | | Descriptor: | PROTEIN (RIBONUCLEASE 4) | | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Rueth, F.X, Coll, M. | | Deposit date: | 1998-10-29 | | Release date: | 1999-10-29 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity.
J.Mol.Biol., 285, 1999
|
|
6TJP
 | | Crystal structure of T7 bacteriophage portal protein, 13mer, closed valve - P212121 | | Descriptor: | Portal protein | | Authors: | Fabrega-Ferrer, M, Cuervo, A, Fernandez, F.J, Machon, C, Perez-Luque, R, Pous, J, Vega, M.C, Carrascosa, J.L, Coll, M. | | Deposit date: | 2019-11-26 | | Release date: | 2020-12-16 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (3.74 Å) | | Cite: | Using a partial atomic model from medium-resolution cryo-EM to solve a large crystal structure.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
4LVM
 | | MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (23nt). Mn-bound crystal structure at pH 6.5 | | Descriptor: | ACTTTAT oligonucleotide, ATAAAGTATAGTGTGT oligonucleotide, CHLORIDE ION, ... | | Authors: | Pluta, R, Boer, D.R, Coll, M. | | Deposit date: | 2013-07-26 | | Release date: | 2014-09-24 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
4LVJ
 | | MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt). Mn-bound crystal structure at pH 5.5 | | Descriptor: | ACETATE ION, ACTTTAT oligonucleotide, ATAAAGTATAGTGTG oligonucleotide, ... | | Authors: | Pluta, R, Boer, D.R, Coll, M. | | Deposit date: | 2013-07-26 | | Release date: | 2014-09-24 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.17 Å) | | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
2BL4
 | | Lactaldehyde:1,2-propanediol oxidoreductase of Escherichia coli | | Descriptor: | CHLORIDE ION, FE (II) ION, LACTALDEHYDE REDUCTASE, ... | | Authors: | Montella, C, Bellsolell, L, Perez-Luque, R, Badia, J, Baldoma, L, Coll, M, Aguilar, J. | | Deposit date: | 2005-03-01 | | Release date: | 2005-07-06 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Crystal Structure of an Iron-Dependent Group III Dehydrogenase that Interconverts L-Lactaldehyde and L-1,2-Propanediol in Escherichia Coli.
J.Bacteriol., 187, 2005
|
|
4LVI
 | | MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt). Mn-bound crystal structure at pH 4.6 | | Descriptor: | ACTTTAT oligonucleotide, ATAAAGTATAGTGTG oligonucleotide, GLYCEROL, ... | | Authors: | Pluta, R, Boer, D.R, Coll, M. | | Deposit date: | 2013-07-26 | | Release date: | 2014-09-24 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
4LVL
 | | MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt+3'Thiophosphate). Mn-bound crystal structure at pH 6.8 | | Descriptor: | CHLORIDE ION, DNA (5'-D(*AP*CP*TP*TP*TP*AP*T)-3'), DNA (5'-D(*AP*TP*AP*AP*AP*GP*TP*AP*TP*AP*GP*TP*GP*TP*GP*(TS6))-3'), ... | | Authors: | Pluta, R, Boer, D.R, Coll, M. | | Deposit date: | 2013-07-26 | | Release date: | 2014-09-24 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
2BI4
 | | Lactaldehyde:1,2-propanediol oxidoreductase of Escherichia coli | | Descriptor: | CHLORIDE ION, FE (III) ION, LACTALDEHYDE REDUCTASE, ... | | Authors: | Montella, C, Bellsolell, L, Badia, J, Baldoma, L, Perez, R, Coll, M, Aguilar, J. | | Deposit date: | 2005-01-20 | | Release date: | 2005-07-06 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Crystal Structure of an Iron-Dependent Group III Dehydrogenase that Interconverts L-Lactaldehyde and L-1,2-Propanediol in Escherichia Coli
J.Bacteriol., 187, 2005
|
|
121D
 | | MOLECULAR STRUCTURE OF THE A-TRACT DNA DODECAMER D(CGCAAATTTGCG) COMPLEXED WITH THE MINOR GROOVE BINDING DRUG NETROPSIN | | Descriptor: | DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)-3'), NETROPSIN | | Authors: | Tabernero, L, Verdaguer, N, Coll, M, Fita, I, Van Der Marel, G.A, Van Boom, J.H, Rich, A, Aymami, J. | | Deposit date: | 1993-04-14 | | Release date: | 1994-01-15 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Molecular structure of the A-tract DNA dodecamer d(CGCAAATTTGCG) complexed with the minor groove binding drug netropsin.
Biochemistry, 32, 1993
|
|
4MNB
 | | Crystal Structure of a complex between the marine anticancer drug Variolin B and DNA | | Descriptor: | 5'-D(*CP*GP*TP*AP*CP*G)-3', 9-amino-5-(2-aminopyrimidin-4-yl)pyrido[3',2':4,5]pyrrolo[1,2-c]pyrimidin-4-ol, COBALT (II) ION, ... | | Authors: | Canals, A, Arribas-Bosacoma, R, Alvarez, M, Albericio, F, Aymami, J, Coll, M. | | Deposit date: | 2013-09-10 | | Release date: | 2015-03-11 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Intercalative DNA binding of the marine anticancer drug variolin B.
Sci Rep, 7, 2017
|
|
5NQ6
 | | Crystal structure of the inhibited form of the redox-sensitive SufE-like sulfur acceptor CsdE from Escherichia coli at 2.40 Angstrom Resolution | | Descriptor: | GLYCEROL, SULFATE ION, Sulfur acceptor protein CsdE | | Authors: | Penya-Soler, E, Aranda, J, Lopez-Estepa, M, Gomez, S, Garces, F, Coll, M, Fernandez, F.J, Vega, M.C. | | Deposit date: | 2017-04-19 | | Release date: | 2018-03-28 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Insights into the inhibited form of the redox-sensitive SufE-like sulfur acceptor CsdE.
PLoS ONE, 12, 2017
|
|
