1FG0
 
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
4V8G
 | | Crystal structure of RMF bound to the 70S ribosome. | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S Ribosomal Protein S10, ... | | Authors: | Polikanov, Y.S, Blaha, G.M, Steitz, T.A. | | Deposit date: | 2011-12-11 | | Release date: | 2014-07-09 | | Last modified: | 2014-12-10 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | How hibernation factors RMF, HPF, and YfiA turn off protein synthesis.
Science, 336, 2012
|
|
4V5H
 | | E.Coli 70s Ribosome Stalled During Translation Of Tnac Leader Peptide. | | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | | Authors: | Seidelt, B, Innis, C.A, Wilson, D.N, Gartmann, M, Armache, J, Villa, E, Trabuco, L.G, Becker, T, Mielke, T, Schulten, K, Steitz, T.A, Beckmann, R. | | Deposit date: | 2009-10-26 | | Release date: | 2014-07-09 | | Last modified: | 2019-12-11 | | Method: | ELECTRON MICROSCOPY (5.8 Å) | | Cite: | Structural insight into nascent polypeptide chain-mediated translational stalling.
Science, 326, 2009
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
5HCR
 | | Crystal structure of antimicrobial peptide Oncocin 10wt bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HCQ
 | | Crystal structure of antimicrobial peptide Oncocin d15-19 bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.801 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HAU
 | | Crystal structure of antimicrobial peptide Bac7(1-19) bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2015-12-30 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HCP
 | | Crystal structure of antimicrobial peptide Metalnikowin bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.894 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5HD1
 | | Crystal structure of antimicrobial peptide Pyrrhocoricin bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Roy, R.N, Lomakin, I.B, Florin, T, Mankin, A.S, Steitz, T.A. | | Deposit date: | 2016-01-04 | | Release date: | 2016-04-06 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition.
Nucleic Acids Res., 44, 2016
|
|
5IPN
 | | SigmaS-transcription initiation complex with 4-nt nascent RNA | | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | | Authors: | Liu, B, Zuo, Y, Steitz, T.A. | | Deposit date: | 2016-03-09 | | Release date: | 2016-03-30 | | Last modified: | 2016-06-22 | | Method: | X-RAY DIFFRACTION (4.61 Å) | | Cite: | Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
5IPL
 | | SigmaS-transcription initiation complex with 4-nt nascent RNA | | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Liu, B, Zuo, Y, Steitz, T.A. | | Deposit date: | 2016-03-09 | | Release date: | 2016-03-30 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.6 Å) | | Cite: | Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
5IPM
 | | SigmaS-transcription initiation complex with 4-nt nascent RNA | | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | | Authors: | Liu, B, Zuo, Y, Steitz, T.A. | | Deposit date: | 2016-03-09 | | Release date: | 2016-03-30 | | Last modified: | 2016-06-22 | | Method: | X-RAY DIFFRACTION (4.2 Å) | | Cite: | Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
5J4C
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with cisplatin (soaked) and bound to mRNA and A-, P- and E-site tRNAs at 2.8A resolution | | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Melnikov, S.V, Soll, D, Steitz, T.A, Polikanov, Y.S. | | Deposit date: | 2016-03-31 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome.
Nucleic Acids Res., 44, 2016
|
|
5J8B
 | | Crystal structure of Elongation Factor 4 (EF-4/LepA) in complex with GDPCP bound to the Thermus thermophilus 70S ribosome | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Gagnon, M.G, Lin, J, Steitz, T.A. | | Deposit date: | 2016-04-07 | | Release date: | 2016-05-25 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Elongation factor 4 remodels the A-site tRNA on the ribosome.
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
5J4B
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with cisplatin (co-crystallized) and bound to mRNA and A-, P- and E-site tRNAs at 2.6A resolution | | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Melnikov, S.V, Soll, D, Steitz, T.A, Polikanov, Y.S. | | Deposit date: | 2016-03-31 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome.
Nucleic Acids Res., 44, 2016
|
|
1KFD
 | |
3CFP
 | | Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 1 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*DAP*DCP*DAP*DGP*DGP*DTP*DAP*DAP*DGP*DCP*DAP*DGP*DTP*DCP*DCP*DGP*DCP*DG)-3'), ... | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
3CFR
 | | Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 2 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*DGP*DCP*DGP*DGP*DAP*DCP*DTP*DGP*DCP*DTP*DTP*DAP*(DOC))-3'), ... | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
3CFO
 | | Triple Mutant APO structure | | Descriptor: | DNA polymerase, GUANOSINE, SULFATE ION | | Authors: | Wang, J, Klimenko, D, Wang, M, Steitz, T.A, Konigsberg, W.H. | | Deposit date: | 2008-03-04 | | Release date: | 2009-03-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Insights into base selectivity from the structures
of an RB69 DNA Polymerase triple mutant
To be Published
|
|
2REB
 | |
4WQU
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G trapped by the antibiotic dityromycin | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQY
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the post-translocational state (without fusitic acid) | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4Y4O
 | | Crystal structure of the Thermus thermophilus 70S ribosome with rRNA modifications and bound to protein Y (YfiA) at 2.3A resolution | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 16S Ribosomal RNA, 23S Ribosomal RNA, ... | | Authors: | Polikanov, Y.S, Melnikov, S.V, Soll, D, Steitz, T.A. | | Deposit date: | 2015-02-10 | | Release date: | 2015-03-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structural insights into the role of rRNA modifications in protein synthesis and ribosome assembly.
Nat.Struct.Mol.Biol., 22, 2015
|
|
4YLP
 | | E. coli Transcription Initiation Complex - 16-bp spacer and 5-nt RNA | | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | | Authors: | Zuo, Y, Steitz, T.A. | | Deposit date: | 2015-03-05 | | Release date: | 2015-04-22 | | Last modified: | 2019-12-25 | | Method: | X-RAY DIFFRACTION (5.5 Å) | | Cite: | Crystal Structures of the E. coli Transcription Initiation Complexes with a Complete Bubble.
Mol.Cell, 58, 2015
|
|
4YLO
 | | E. coli Transcription Initiation Complex - 16-bp spacer and 4-nt RNA | | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | | Authors: | Zuo, Y, Steitz, T.A. | | Deposit date: | 2015-03-05 | | Release date: | 2015-04-22 | | Last modified: | 2019-12-25 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal Structures of the E. coli Transcription Initiation Complexes with a Complete Bubble.
Mol.Cell, 58, 2015
|
|
