8B2N
| Potempin A (PotA) from Tannerella forsythia in complex with the catalytic domain of human MMP-12 | Descriptor: | CALCIUM ION, Macrophage metalloelastase, Tannerella forsythia potempin A (PotA), ... | Authors: | Potempa, J, Ksiazek, M, Goulas, T, Cuppari, A, Rodriguez-Banqueri, A, Arolas, J.L, Lopez-Pelegrin, M, Garcia-Ferrer, I, Guevara, T. | Deposit date: | 2022-09-14 | Release date: | 2022-12-21 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | A unique network of attack, defence and competence on the outer membrane of the periodontitis pathogen Tannerella forsythia. Chem Sci, 14, 2023
|
|
8B2M
| Matrix-metallopeptidase inhibitor Potempin A (PotA) from Tannerella forsythia | Descriptor: | NICKEL (II) ION, Tannerella forsythia Potempin A (PotA) | Authors: | Potempa, J, Ksiazek, M, Goulas, T, Cuppari, A, Rodriguez-Banqueri, A, Arolas, J.L, Lopez-Pelegrin, M, Garcia-Ferrer, I, Guevara, T. | Deposit date: | 2022-09-14 | Release date: | 2022-12-21 | Last modified: | 2023-02-22 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | A unique network of attack, defence and competence on the outer membrane of the periodontitis pathogen Tannerella forsythia. Chem Sci, 14, 2023
|
|
8B2Q
| Matrix-metallopeptidase inhibitor Potempin A (PotA) from Tannerella forsythia in complex with T. forsythia karilysin. | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CALCIUM ION, GLYCEROL, ... | Authors: | Potempa, J, Ksiazek, M, Goulas, T, Cuppari, A, Rodriguez-Banqueri, A, Arolas, J.L, Lopez-Pelegrin, M, Garcia-Ferrer, I, Guevara, T. | Deposit date: | 2022-09-14 | Release date: | 2022-12-21 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | A unique network of attack, defence and competence on the outer membrane of the periodontitis pathogen Tannerella forsythia. Chem Sci, 14, 2023
|
|
5CX8
| Structure of RagB, a major immunodominant virulence factor of Porphyromonas gingivalis. | Descriptor: | 3-deoxy-5-O-phosphono-beta-D-ribofuranose, 3-deoxy-beta-D-glucopyranose, 6-O-phosphono-D-tagatose, ... | Authors: | Goulas, T, Garcia-Ferrer, I, Hutcherson, J.A, Potempa, B.A, Potempa, J, Scott, D.A, Gomis-Ruth, F.X. | Deposit date: | 2015-07-28 | Release date: | 2015-10-21 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of RagB, a major immunodominant outer-membrane surface receptor antigen of Porphyromonas gingivalis. Mol Oral Microbiol, 31, 2016
|
|
5HFS
| CRYSTAL STRUCTURE OF C-TERMINAL DOMAIN OF CARGO PROTEINS OF TYPE IX SECRETION SYSTEM | Descriptor: | CALCIUM ION, Gingipain R2, ZINC ION | Authors: | Golik, P, Szmigielski, B, Ksiazek, M, Nowakowska, Z, Mizgalska, D, Nowak, M, Dubin, G, Potempa, J. | Deposit date: | 2016-01-07 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | The outer-membrane export signal of Porphyromonas gingivalis type IX secretion system (T9SS) is a conserved C-terminal beta-sandwich domain. Sci Rep, 6, 2016
|
|
1Y4H
| Wild type staphopain-staphostatin complex | Descriptor: | CHLORIDE ION, SULFATE ION, cysteine protease, ... | Authors: | Filipek, R, Potempa, J, Bochtler, M. | Deposit date: | 2004-11-30 | Release date: | 2005-01-18 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (1.93 Å) | Cite: | A comparison of staphostatin B with standard mechanism serine protease inhibitors. J.Biol.Chem., 280, 2005
|
|
6I0X
| Porphyromonas gingivalis peptidylarginine deminase (PPAD) mutant G231N/E232T/N235D in complex with Cl-amidine. | Descriptor: | GLYCEROL, N-[(1S)-1-(AMINOCARBONYL)-4-(ETHANIMIDOYLAMINO)BUTYL]BENZAMIDE, Peptidylarginine deiminase, ... | Authors: | Gomis-Ruth, F.X, Goulas, T, Sola, M, Potempa, J. | Deposit date: | 2018-10-26 | Release date: | 2019-01-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure, function, and inhibition of a genomic/clinical variant of Porphyromonas gingivalis peptidylarginine deiminase. Protein Sci., 28, 2019
|
|
4RBM
| Porphyromonas gingivalis gingipain K (Kgp) catalytic and immunoglobulin superfamily-like domains | Descriptor: | (3S)-3,7-diaminoheptan-2-one, ACETATE ION, AZIDE ION, ... | Authors: | de Diego, I, Veillard, F, Sztukowska, M.N, Guevara, T, Potempa, B, Pomowski, A, Huntington, J.A, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2014-09-12 | Release date: | 2014-10-08 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Structure and Mechanism of Cysteine Peptidase Gingipain K (Kgp), a Major Virulence Factor of Porphyromonas gingivalis in Periodontitis. J.Biol.Chem., 289, 2014
|
|
4MVN
| Crystal structure of the staphylococcal serine protease SplA in complex with a specific phosphonate inhibitor | Descriptor: | Serine protease splA, [(1S)-1-{[(benzyloxy)carbonyl]amino}-2-phenylethyl]phosphonic acid | Authors: | Zdzalik, M, Burchacka, E, Niemczyk, J.S, Pustelny, K, Popowicz, G.M, Wladyka, B, Dubin, A, Potempa, J, Sienczyk, M, Dubin, G, Oleksyszyn, J. | Deposit date: | 2013-09-24 | Release date: | 2014-01-22 | Last modified: | 2024-10-30 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Development and binding characteristics of phosphonate inhibitors of SplA protease from Staphylococcus aureus. Protein Sci., 23, 2014
|
|
1HLE
| CRYSTAL STRUCTURE OF CLEAVED EQUINE LEUCOCYTE ELASTASE INHIBITOR DETERMINED AT 1.95 ANGSTROMS RESOLUTION | Descriptor: | CALCIUM ION, HORSE LEUKOCYTE ELASTASE INHIBITOR | Authors: | Baumann, U, Bode, W, Huber, R, Travis, J, Potempa, J. | Deposit date: | 1992-04-13 | Release date: | 1994-01-31 | Last modified: | 2017-11-29 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Crystal structure of cleaved equine leucocyte elastase inhibitor determined at 1.95 A resolution. J.Mol.Biol., 226, 1992
|
|
2XS4
| Structure of karilysin catalytic MMP domain in complex with magnesium | Descriptor: | CHLORIDE ION, KARILYSIN PROTEASE, MAGNESIUM ION, ... | Authors: | Cerda-Costa, N, Guevara, T, Karim, A.Y, Ksiazek, M, Nguyen, K.-A, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2010-09-24 | Release date: | 2010-11-03 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | The Structure of the Catalytic Domain of Tannerella Forsythia Karilysin Reveals It is a Bacterial Xenologue of Animal Matrix Metalloproteinases. Mol.Microbiol., 79, 2011
|
|
2XS3
| Structure of karilysin catalytic MMP domain | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, KARILYSIN PROTEASE, PEPTIDE ALA-PHE-THR-SER, ... | Authors: | Cerda-Costa, N, Guevara, T, Karim, A.Y, Ksiazek, M, Nguyen, K.-A, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2010-09-24 | Release date: | 2010-11-03 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The Structure of the Catalytic Domain of Tannerella Forsythia Karilysin Reveals It is a Bacterial Xenologue of Animal Matrix Metalloproteinases. Mol.Microbiol., 79, 2011
|
|
5AG8
| CRYSTAL STRUCTURE OF A MUTANT (665I6H) OF THE C-TERMINAL DOMAIN OF RGPB | Descriptor: | GINGIPAIN R2, GLYCEROL, SULFATE ION | Authors: | de Diego, I, Ksiazek, M, Mizgalska, D, Golik, P, Szmigielski, B, Nowak, M, Nowakowska, Z, Potempa, B, Koneru, L, Nguyen, K.A, Enghild, J, Thogersen, I.B, Dubin, G, Gomis-Ruth, F.X, Potempa, J. | Deposit date: | 2015-01-29 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The Outer-Membrane Export Signal of Porphyromonas Gingivalis Type Ix Secretion System (T9Ss) is a Conserved C-Terminal Beta-Sandwich Domain. Sci.Rep., 6, 2016
|
|
5AG9
| CRYSTAL STRUCTURE OF A MUTANT (665sXa) C-TERMINAL DOMAIN OF RGPB | Descriptor: | Gingipain R2, SULFATE ION | Authors: | de Diego, I, Ksiazek, M, Mizgalska, D, Golik, P, Szmigielski, B, Nowak, M, Nowakowska, Z, Potempa, B, Koneru, L, Nguyen, K.A, Enghild, J, Thogersen, I.B, Dubin, G, Gomis-Ruth, F.X, Potempa, J. | Deposit date: | 2015-01-29 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.11 Å) | Cite: | The outer-membrane export signal of Porphyromonas gingivalis type IX secretion system (T9SS) is a conserved C-terminal beta-sandwich domain. Sci Rep, 6, 2016
|
|
2VID
| Serine protease SplB from Staphylococcus aureus at 1.8A resolution | Descriptor: | SERINE PROTEASE SPLB | Authors: | Dubin, G, Stec-Niemczyk, J, Kisielewska, M, Pustelny, K, Popowicz, G.M, Bista, M, Kantyka, T, Boulware, K.T, Stennicke, H.R, Czarna, A, Phopaisarn, M, Daugherty, P.S, Thogersen, I.B, Enghild, J.J, Thornberry, N, Dubin, A, Potempa, J. | Deposit date: | 2007-11-30 | Release date: | 2008-05-13 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Enzymatic Activity of the Staphylococcus Aureus Splb Serine Protease is Induced by Substrates Containing the Sequence Trp-Glu-Leu-Gln. J.Mol.Biol., 379, 2008
|
|
2W7U
| SplA serine protease of Staphylococcus aureus (2.4A) | Descriptor: | SERINE PROTEASE SPLA | Authors: | Stec-Niemczyka, J, Pustelny, K, Kisielewska, M, Bista, M, Boulware, K.T, Stennicke, H.R, Thogersen, I.B, Daugherty, P.S, Enghild, J.J, Popowicz, G.M, Dubin, A, Potempa, J, Dubin, G. | Deposit date: | 2008-12-30 | Release date: | 2010-03-31 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.43 Å) | Cite: | Structural and Functional Characterization of Spla, an Exclusively Specific Protease of Staphylococcus Aureus. Biochem.J., 419, 2009
|
|
2W7S
| SplA serine protease of Staphylococcus aureus (1.8A) | Descriptor: | SERINE PROTEASE SPLA | Authors: | Stec-Niemczyka, J, Pustelny, K, Kisielewska, M, Bista, M, Boulware, K.T, Stennicke, H.R, Thogersen, I.B, Daugherty, P.S, Enghild, J.J, Popowicz, G.M, Dubin, A, Potempa, J, Dubin, G. | Deposit date: | 2008-12-30 | Release date: | 2010-03-31 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural and Functional Characterization of Spla, an Exclusively Specific Protease of Staphylococcus Aureus Biochem.J., 419, 2009
|
|
1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
4IEF
| Complex of Porphyromonas gingivalis RgpB pro- and mature domains | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, BARIUM ION, CALCIUM ION, ... | Authors: | de Diego, I, Veillard, F.T, Guevara, T, Potempa, B, Sztukowska, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2012-12-13 | Release date: | 2013-04-10 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Porphyromonas gingivalis Virulence Factor Gingipain RgpB Shows a Unique Zymogenic Mechanism for Cysteine Peptidases. J.Biol.Chem., 288, 2013
|
|
4YTG
| Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) mutant C351A in complex with dipeptide Met-Arg. | Descriptor: | ARGININE, AZIDE ION, CHLORIDE ION, ... | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2015-03-17 | Release date: | 2015-07-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase. Sci Rep, 5, 2015
|
|
4YT9
| Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) substrate-unbound. | Descriptor: | GLYCEROL, Peptidylarginine deiminase, SODIUM ION | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2015-03-17 | Release date: | 2015-07-15 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase. Sci Rep, 5, 2015
|
|
4YTB
| Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) in complex with dipeptide Asp-Gln. | Descriptor: | ASPARTIC ACID, AZIDE ION, CHLORIDE ION, ... | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2015-03-17 | Release date: | 2015-07-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase. Sci Rep, 5, 2015
|
|
6ZA2
| Crystal structure of dimeric latent PorU from Porphyromonas gingivalis | Descriptor: | CALCIUM ION, Por secretion system protein porU | Authors: | Gomis-Ruth, F.X, Goulas, T, Guevara, T, Rodriguez-Banqueri, A, Potempa, J. | Deposit date: | 2020-06-04 | Release date: | 2021-09-29 | Last modified: | 2024-06-19 | Method: | X-RAY DIFFRACTION (3.35 Å) | Cite: | Intermolecular latency regulates the essential C-terminal signal peptidase and sortase of the Porphyromonas gingivalis type-IX secretion system. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
5MUN
| Structural insight into zymogenic latency of gingipain K from Porphyromonas gingivalis. | Descriptor: | AZIDE ION, Lys-gingipain W83 | Authors: | Pomowski, A, Uson, I, Nowakovska, Z, Veillard, F, Sztukowska, M.N, Guevara, T, Goulas, T, Mizgalska, D, Nowak, M, Potempa, B, Huntington, J.A, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2017-01-13 | Release date: | 2017-02-22 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome. J. Biol. Chem., 292, 2017
|
|
2AS9
| Functional and structural characterization of Spl proteases from staphylococcus aureus | Descriptor: | ZINC ION, serine protease | Authors: | Popowicz, G.M, Dubin, G, Stec-Niemczyk, J, Czarny, A, Dubin, A, Potempa, J, Holak, T.A. | Deposit date: | 2005-08-23 | Release date: | 2005-09-06 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Functional and Structural Characterization of Spl Proteases from Staphylococcus aureus J.Mol.Biol., 358, 2006
|
|