Author results

2IWB
  • Download 2iwb
  • View 2iwb
Molmil generated image of 2iwb
MECR1 UNBOUND EXTRACELLULAR ANTIBIOTIC-SENSOR DOMAIN.
Descriptor:METHICILLIN RESISTANCE MECR1 PROTEIN, TETRAPEPTIDE, NICKEL (II) ION, ...
Authors:Marrero, A., Mallorqui-Fernandez, G., Guevara, T., Garcia-Castellanos, R., Gomis-Ruth, F.X.
Deposit date:2006-06-27
Release date:2006-07-04
Last modified:2019-05-08
Method:X-RAY DIFFRACTION (1.8 Å)
Cite:Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
2IWC
  • Download 2iwc
  • View 2iwc
Molmil generated image of 2iwc
BENZYLPENICILLOYL-ACYLATED MECR1 EXTRACELLULAR ANTIBIOTIC-SENSOR DOMAIN.
Descriptor:METHICILLIN RESISTANCE MECR1 PROTEIN, OPEN FORM - PENICILLIN G
Authors:Marrero, A., Mallorqui-Fernandez, G., Guevara, T., Garcia-Castellanos, R., Gomis-Ruth, F.X.
Deposit date:2006-06-27
Release date:2006-07-04
Last modified:2018-10-24
Method:X-RAY DIFFRACTION (2.1 Å)
Cite:Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
2IWD
  • Download 2iwd
  • View 2iwd
Molmil generated image of 2iwd
OXACILLOYL-ACYLATED MECR1 EXTRACELLULAR ANTIBIOTIC-SENSOR DOMAIN.
Descriptor:Methicillin resistance mecR1 protein, (2R,4S)-5,5-dimethyl-2-[(1R)-1-{[(5-methyl-3-phenyl-1,2-oxazol-4-yl)carbonyl]amino}-2-oxoethyl]-1,3-thiazolidine-4-carboxylic acid
Authors:Marrero, A., Mallorqui-Fernandez, G., Guevara, T., Garcia-Castellanos, R., Gomis-Ruth, F.X.
Deposit date:2006-06-27
Release date:2006-07-03
Last modified:2018-06-20
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
4ACQ
  • Download 4acq
  • View 4acq
Molmil generated image of 4acq
ALPHA-2 MACROGLOBULIN
Descriptor:ALPHA-2-MACROGLOBULIN, N-ACETYL-D-GLUCOSAMINE, ALPHA-D-MANNOSE
Authors:Marrero, A., Duquerroy, S., Trapani, S., Goulas, T., Guevara, T., Andersen, G.R., Navaza, J., Sottrup-Jensen, L., Gomis-Ruth, F.X.
Deposit date:2011-12-17
Release date:2012-02-22
Last modified:2019-01-30
Method:X-RAY DIFFRACTION (4.3 Å)
Cite:The crystal structure of human alpha 2-macroglobulin reveals a unique molecular cage.
Angew. Chem. Int. Ed. Engl., 51, 2012
1SAX
  • Download 1sax
  • View 1sax
Molmil generated image of 1sax
THREE-DIMENSIONAL STRUCTURE OF S.AUREUS METHICILLIN-RESISTANCE REGULATING TRANSCRIPTIONAL REPRESSOR MECI IN COMPLEX WITH 25-BP DS-DNA
Descriptor:5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', Methicillin resistance regulatory protein mecI, ...
Authors:Garcia-Castellanos, R., Mallorqui-Fernandez, G., Marrero, A., Potempa, J., Coll, M., Gomis-Ruth, F.X.
Deposit date:2004-02-09
Release date:2004-04-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
2PCU
  • Download 2pcu
  • View 2pcu
Molmil generated image of 2pcu
HUMAN CARBOXYPEPTIDASE A4 IN COMPLEX WITH A CLEAVED HEXAPEPTIDE.
Descriptor:Carboxypeptidase A4, peptide, N-ACETYL-D-GLUCOSAMINE, ...
Authors:Bayes, A., Fernandez, D., Sola, M., Marrero, A., Garcia-Pique, S., Aviles, F.X., Vendrell, J., Gomis-Ruth, F.X.
Deposit date:2007-03-30
Release date:2007-04-17
Last modified:2017-10-18
Method:X-RAY DIFFRACTION (1.6 Å)
Cite:Caught after the Act: a human A-type metallocarboxypeptidase in a product complex with a cleaved hexapeptide.
Biochemistry, 46, 2007
1OKR
  • Download 1okr
  • View 1okr
Molmil generated image of 1okr
THREE-DIMENSIONAL STRUCTURE OF S.AUREUS METHICILLIN-RESISTANCE REGULATING TRANSCRIPTIONAL REPRESSOR MECI.
Descriptor:METHICILLIN RESISTANCE REGULATORY PROTEIN MECI, GLYCEROL, CHLORIDE ION
Authors:Garcia-Castellanos, R., Marrero, A., Mallorqui-Fernandez, G., Potempa, J., Coll, M., Gomis-Ruth, F.X.
Deposit date:2003-07-28
Release date:2003-10-09
Last modified:2019-04-03
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance
J.Biol.Chem., 278, 2003
2J83
  • Download 2j83
  • View 2j83
Molmil generated image of 2j83
ULILYSIN METALLOPROTEASE IN COMPLEX WITH BATIMASTAT.
Descriptor:ULILYSIN, 4-(N-HYDROXYAMINO)-2R-ISOBUTYL-2S-(2-THIENYLTHIOMETHYL)SUCCINYL-L-PHENYLALANINE-N-METHYLAMIDE, CALCIUM ION, ...
Authors:Garcia-Castellanos, R., Tallant, C., Marrero, A., Sola, M., Baumann, U., Gomis-Ruth, F.X.
Deposit date:2006-10-18
Release date:2006-12-19
Last modified:2019-05-08
Method:X-RAY DIFFRACTION (2 Å)
Cite:Substrate Specificity of a Metalloprotease of the Pappalysin Family Revealed by an Inhibitor and a Product Complex.
Arch.Biochem.Biophys., 457, 2007
3RAM
  • Download 3ram
  • View 3ram
Molmil generated image of 3ram
CRYSTAL STRUCTURE OF HMRA
Descriptor:HmrA protein, ZINC ION, GLYCEROL
Authors:Botelho, T., Guevara, T., Marrero, A., Gomis-Ruth, F.X.
Deposit date:2011-03-28
Release date:2011-05-25
Last modified:2011-08-10
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Structural and Functional Analyses Reveal That Staphylococcus aureus Antibiotic Resistance Factor HmrA Is a Zinc-dependent Endopeptidase.
J.Biol.Chem., 286, 2011