Author results

1FMN
  • Download 1fmn
  • View 1fmn
Molmil generated image of 1fmn
SOLUTION STRUCTURE OF FMN-RNA APTAMER COMPLEX, NMR, 5 STRUCTURES
Descriptor:RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP *AP*UP*AP*UP*GP*CP*UP*UP*CP*GP*GP*CP*AP*GP*AP*AP*GP *GP*AP*CP*AP*CP*GP*CP*C)-3'), FLAVIN MONONUCLEOTIDE
Authors:Fan, P., Suri, A.K., Fiala, R., Live, D., Patel, D.J.
Deposit date:1995-12-04
Release date:1996-07-11
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Molecular recognition in the FMN-RNA aptamer complex.
J.Mol.Biol., 258, 1996
1G70
  • Download 1g70
  • View 1g70
Molmil generated image of 1g70
COMPLEX OF HIV-1 RRE-IIB RNA WITH RSG-1.2 PEPTIDE
Descriptor:HIV-1 RRE-IIB 32 NUCLEOTIDE RNA, RSG-1.2 PEPTIDE
Authors:Gosser, Y., Hermann, T., Majumdar, A., Hu, W., Frederick, R., Jiang, F., Xu, W., Patel, D.J.
Deposit date:2000-11-08
Release date:2001-02-07
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Peptide-triggered conformational switch in HIV-1 RRE RNA complexes.
Nat.Struct.Biol., 8, 2001
1I34
  • Download 1i34
  • View 1i34
Molmil generated image of 1i34
SOLUTION DNA QUADRUPLEX WITH DOUBLE CHAIN REVERSAL LOOP AND TWO DIAGONAL LOOPS CONNECTING GGGG TETRADS FLANKED BY G-(T-T) TRIAD AND T-T-T TRIPLE
Descriptor:5'-D(*GP*GP*TP*TP*TP*TP*GP*GP*CP*AP*GP*GP*GP*TP*TP*TP*TP*GP*GP*T)-3'
Authors:Kuryavyi, V., Majumdar, A., Shallop, A., Chernichenko, N., Skripkin, E., Jones, R., Patel, D.J.
Deposit date:2001-02-12
Release date:2001-06-27
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.
J.Mol.Biol., 310, 2001
1JJP
  • Download 1jjp
  • View 1jjp
Molmil generated image of 1jjp
A(GGGG) PENTAD-CONTAINING DIMERIC DNA QUADRUPLEX INVOLVING STACKED G(ANTI)G(ANTI)G(ANTI)G(SYN) TETRADS
Descriptor:5'-D(*GP*GP*GP*AP*GP*GP*TP*TP*TP*GP*GP*GP*AP*T)-3'
Authors:Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J.
Deposit date:2001-07-09
Release date:2001-09-19
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads.
J.Mol.Biol., 311, 2001
1JO1
  • Download 1jo1
  • View 1jo1
Molmil generated image of 1jo1
N7-GUANINE ADDUCT OF 2,7-DIAMINOMITOSENE WITH DNA
Descriptor:5'-D(*GP*TP*GP*(DAJ)GP*TP*AP*TP*AP*CP*CP*AP*C)-3', DECARBAMOYL-2,7-DIAMINOMITOSENE
Authors:Subramaniam, G., Paz, M.M., Kumar, G.S., Das, A., Palom, Y., Clement, C.C., Patel, D.J., Tomasz, M.
Deposit date:2001-07-26
Release date:2001-09-12
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a guanine-N7-linked complex of the mitomycin C metabolite 2,7-diaminomitosene and DNA. Basis of sequence selectivity.
Biochemistry, 40, 2001
1JVC
  • Download 1jvc
  • View 1jvc
Molmil generated image of 1jvc
DIMERIC DNA QUADRUPLEX CONTAINING MAJOR GROOVE-ALIGNED A.T.A.T AND G.C.G.C TETRADS STABILIZED BY INTER-SUBUNIT WATSON-CRICK A:T AND G:C PAIRS
Descriptor:5'-D(*GP*AP*GP*CP*AP*GP*GP*T)-3'
Authors:Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J.
Deposit date:2001-08-29
Release date:2001-10-24
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs.
J.Mol.Biol., 312, 2001
1L4S
  • Download 1l4s
  • View 1l4s
Molmil generated image of 1l4s
SOLUTION STRUCTURE OF RIBOSOME ASSOCIATED FACTOR Y
Descriptor:Protein yfiA
Authors:Ye, K., Serganov, A., Hu, W., Patel, D.J.
Deposit date:2002-03-05
Release date:2002-12-04
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold.
Eur.J.Biochem., 269, 2002
1NEM
  • Download 1nem
  • View 1nem
Molmil generated image of 1nem
SACCHARIDE-RNA RECOGNITION IN THE NEOMYCIN B / RNA APTAMER COMPLEX
Descriptor:5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*GP*AP*AP*GP*UP*UP*UP*AP*GP*UP*CP*C)-3', BETA-D-RIBOFURANOSYL, O-2,6-DIAMINO-2,6-DIDEOXY-BETA-L-IDOPYRANOSE, ...
Authors:Jiang, L., Majumdar, A., Hu, W., Jaishree, T.J., Xu, W., Patel, D.J.
Deposit date:1999-03-15
Release date:1999-08-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Saccharide-RNA recognition in a complex formed between neomycin B and an RNA aptamer
Structure Fold.Des., 7, 1999
1NTA
  • Download 1nta
  • View 1nta
Molmil generated image of 1nta
2.9 A CRYSTAL STRUCTURE OF STREPTOMYCIN RNA-APTAMER
Descriptor:5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*GP*GP*AP*CP*UP*UP*CP*UP*GP*CP*C)-3', 5'-R(*CP*GP*GP*CP*AP*CP*CP*AP*CP*GP*GP*UP*CP*GP*GP*AP*UP*C)-3', BARIUM ION, ...
Authors:Tereshko, V., Skripkin, E., Patel, D.J.
Deposit date:2003-01-29
Release date:2003-05-13
Last modified:2017-05-10
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Encapsulating Streptomycin within a small 40-mer RNA
CHEM.BIOL., 10, 2003
1NTB
  • Download 1ntb
  • View 1ntb
Molmil generated image of 1ntb
2.9 A CRYSTAL STRUCTURE OF STREPTOMYCIN RNA-APTAMER COMPLEX
Descriptor:5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*GP*GP*AP*CP*UP*UP*CP*UP*GP*CP*C)-3', 5'-R(*CP*GP*GP*CP*AP*CP*CP*AP*CP*GP*GP*UP*CP*GP*GP*AP*UP*C)-3', SODIUM ION, ...
Authors:Tereshko, V., Skripkin, E., Patel, D.J.
Deposit date:2003-01-29
Release date:2003-05-13
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Encapsulating Streptomycin within a small 40-mer RNA
CHEM.BIOL., 10, 2003
1OLD
  • Download 1old
  • View 1old
Molmil generated image of 1old
NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES
Descriptor:DNA (GATCGAAACGTAGCGCCTTCGATC), DEOXY-METHYL-ARGININE
Authors:Lin, C.H., Patel, D.J.
Deposit date:1996-10-31
Release date:1997-04-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Encapsulating an amino acid in a DNA fold.
Nat.Struct.Biol., 3, 1996
1OYX
  • Download 1oyx
  • View 1oyx
Molmil generated image of 1oyx
CRYSTAL STRUCTURE OF 3-MBT REPEATS OF LETHAL (3) MALIGNANT BRAIN TUMOR (SELENO-MET) AT 1.85 ANGSTROM
Descriptor:Lethal(3)malignant brain tumor-like protein, SULFATE ION, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Authors:Wang, W.K., Tereshko, V., Boccuni, P., MacGrogan, D., Nimer, S.D., Patel, D.J.
Deposit date:2003-04-07
Release date:2003-08-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.85 Å)
Cite:Malignant brain tumor repeats: a three-leaved propeller architecture with ligand/peptide binding pockets.
Structure, 11, 2003
1OZ2
  • Download 1oz2
  • View 1oz2
Molmil generated image of 1oz2
CRYSTAL STRUCTURE OF 3-MBT REPEATS OF LETHAL (3) MALIGNANT BRAIN TUMOR (NATIVE-II) AT 1.55 ANGSTROM
Descriptor:Lethal(3)malignant brain tumor-like protein, SULFATE ION, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Authors:Wang, W.K., Tereshko, V., Boccuni, P., MacGrogan, D., Nimer, S.D., Patel, D.J.
Deposit date:2003-04-07
Release date:2003-08-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.55 Å)
Cite:Malignant brain tumor repeats: a three-leaved propeller architecture with ligand/peptide binding pockets.
Structure, 11, 2003
1OZ3
  • Download 1oz3
  • View 1oz3
Molmil generated image of 1oz3
CRYSTAL STRUCTURE OF 3-MBT REPEATS OF LETHAL (3) MALIGNANT BRAIN TUMOR (NATIVE-I) AT 1.85 ANGSTROM
Descriptor:Lethal(3)malignant brain tumor-like protein, SULFATE ION, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Authors:Wang, W.K., Tereshko, V., Boccuni, P., MacGrogan, D., Nimer, S.D., Patel, D.J.
Deposit date:2003-04-07
Release date:2003-08-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.85 Å)
Cite:Malignant brain tumor repeats: a three-leaved propeller architecture with ligand/peptide binding pockets.
Structure, 11, 2003
1R9F
  • Download 1r9f
  • View 1r9f
Molmil generated image of 1r9f
CRYSTAL STRUCTURE OF P19 COMPLEXED WITH 19-BP SMALL INTERFERING RNA
Descriptor:5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*UP*AP*CP*UP*UP*CP*GP*AP*UP*U)-3', 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*CP*GP*CP*GP*UP*AP*CP*GP*UP*U)-3', Core protein P19, ...
Authors:Ye, K., Malinina, L., Patel, D.J.
Deposit date:2003-10-28
Release date:2004-01-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.85 Å)
Cite:Recognition of small interfering RNA by a viral suppressor of RNA
Nature, 426, 2003
1SWX
  • Download 1swx
  • View 1swx
Molmil generated image of 1swx
CRYSTAL STRUCTURE OF A HUMAN GLYCOLIPID TRANSFER PROTEIN IN APO-FORM
Descriptor:Glycolipid transfer protein, HEXANE
Authors:Malinina, L., Malakhova, M.L., Teplov, A., Brown, R.E., Patel, D.J.
Deposit date:2004-03-30
Release date:2004-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.65 Å)
Cite:Structural basis for glycosphingolipid transfer specificity.
Nature, 430, 2004
1SX6
  • Download 1sx6
  • View 1sx6
Molmil generated image of 1sx6
CRYSTAL STRUCTURE OF HUMAN GLYCOLIPID TRANSFER PROTEIN IN LACTOSYLCERAMIDE-BOUND FORM
Descriptor:Glycolipid transfer protein, BETA-LACTOSE, SPHINGOSINE, ...
Authors:Malinina, L., Malakhova, M.L., Teplov, A., Brown, R.E., Patel, D.J.
Deposit date:2004-03-30
Release date:2004-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.95 Å)
Cite:Structural basis for glycosphingolipid transfer specificity.
Nature, 430, 2004
1TJM
  • Download 1tjm
  • View 1tjm
Molmil generated image of 1tjm
CRYSTALLOGRAPHIC IDENTIFICATION OF SR2+ COORDINATION SITE IN SYNAPTOTAGMIN I C2B DOMAIN
Descriptor:Synaptotagmin I, STRONTIUM ION, GLYCEROL
Authors:Cheng, Y., Sequeira, S.M., Malinina, L., Tereshko, V., Sollner, T.H., Patel, D.J.
Deposit date:2004-06-06
Release date:2004-09-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.18 Å)
Cite:Crystallographic identification of Ca2+ and Sr2+ coordination sites in synaptotagmin I C2B domain
Protein Sci., 13, 2004
1TJX
  • Download 1tjx
  • View 1tjx
Molmil generated image of 1tjx
CRYSTALLOGRAPHIC IDENTIFICATION OF CA2+ COORDINATION SITES IN SYNAPTOTAGMIN I C2B DOMAIN
Descriptor:similar to synaptotagminI/p65, CALCIUM ION, ACETATE ION, ...
Authors:Cheng, Y., Sequeira, S.M., Malinina, L., Tereshko, V., Sollner, T.H., Patel, D.J.
Deposit date:2004-06-07
Release date:2004-11-23
Last modified:2012-04-11
Method:X-RAY DIFFRACTION (1.04 Å)
Cite:Crystallographic identification of Ca2+ and Sr2+ coordination sites in synaptotagmin I C2B domain.
Protein Sci., 13, 2004
1TOB
  • Download 1tob
  • View 1tob
Molmil generated image of 1tob
SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES
Descriptor:RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3'), 3-DEOXY-3-AMINO GLUCOSE, 2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE, ...
Authors:Jiang, L., Suri, A.K., Fiala, R., Patel, D.J.
Deposit date:1996-12-12
Release date:1997-06-16
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex.
Chem.Biol., 4, 1997
1ULL
  • Download 1ull
  • View 1ull
Molmil generated image of 1ull
RNA APTAMER COMPLEXED WITH HIV-1 REV PEPTIDE, NMR, 7 STRUCTURES
Descriptor:RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP*GP*UP*AP*CP*UP*UP*CP*GP* GP*UP*AP*CP*UP*GP*GP*AP*GP*AP*AP*AP*CP*AP*GP*CP*C)-3'), REV PEPTIDE
Authors:Ye, X., Gorin, A., Ellington, A.D., Patel, D.J.
Deposit date:1996-11-05
Release date:1997-08-20
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Deep penetration of an alpha-helix into a widened RNA major groove in the HIV-1 rev peptide-RNA aptamer complex.
Nat.Struct.Biol., 3, 1996
1UOV
  • Download 1uov
  • View 1uov
Molmil generated image of 1uov
CALCIUM BINDING DOMAIN C2B
Descriptor:SYNAPTOTAGMIN I, CALCIUM ION, GLYCEROL
Authors:Cheng, Y., Sequeira, S.M., Sollner, T.H., Patel, D.J.
Deposit date:2003-09-24
Release date:2004-09-09
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.65 Å)
Cite:Crystallographic Identification of Ca2+ and Sr2+ Coordination Sites in Synaptotagmin I C2B Domain
Protein Sci., 13, 2004
1UOW
  • Download 1uow
  • View 1uow
Molmil generated image of 1uow
CALCIUM BINDING DOMAIN C2B
Descriptor:SYNAPTOTAGMIN I, CALCIUM ION, GLYCEROL, ...
Authors:Cheng, Y., Sequeira, S.M., Sollner, T.H., Patel, D.J.
Deposit date:2003-09-24
Release date:2004-09-16
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.04 Å)
Cite:Crystallographic Identification of Ca2+ and Sr2+ Coordination Sites in Synaptotagmin I C2B Domain
Protein Sci., 13, 2004
1Y26
  • Download 1y26
  • View 1y26
Molmil generated image of 1y26
A-RIBOSWITCH-ADENINE COMPLEX
Descriptor:Vibrio vulnificus A-riboswitch, MAGNESIUM ION, ADENINE
Authors:Serganov, A., Yuan, Y.R., Patel, D.J.
Deposit date:2004-11-20
Release date:2004-12-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.1 Å)
Cite:Structural Basis for Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs
Chem.Biol., 11, 2004
1Y27
  • Download 1y27
  • View 1y27
Molmil generated image of 1y27
G-RIBOSWITCH-GUANINE COMPLEX
Descriptor:Bacillus subtilis xpt, GUANINE
Authors:Serganov, A., Yuan, Y.R., Patel, D.J.
Deposit date:2004-11-20
Release date:2004-12-28
Last modified:2019-02-27
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Structural Basis for Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs
Chem.Biol., 11, 2004