8SOK
| |
4JS4
| |
4JS5
| |
7BGB
| The H/ACA RNP lobe of human telomerase | Descriptor: | H/ACA ribonucleoprotein complex subunit 1, H/ACA ribonucleoprotein complex subunit 2, H/ACA ribonucleoprotein complex subunit 3, ... | Authors: | Nguyen, T.H.D, Ghanim, G.E, Fountain, A.J, van Roon, A.M.M, Rangan, R, Das, R, Collins, K. | Deposit date: | 2021-01-06 | Release date: | 2021-04-28 | Last modified: | 2024-05-01 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Structure of human telomerase holoenzyme with bound telomeric DNA. Nature, 593, 2021
|
|
6QTK
| 2.31A structure of gepotidacin with S.aureus DNA gyrase and doubly nicked DNA | Descriptor: | (3~{R})-3-[[4-(3,4-dihydro-2~{H}-pyrano[2,3-c]pyridin-6-ylmethylamino)piperidin-1-yl]methyl]-1,4,7-triazatricyclo[6.3.1.0^{4,12}]dodeca-6,8(12),9-triene-5,11-dione, DNA (5'-D(*AP*GP*CP*CP*GP*TP*AP*G*GP*GP*TP*AP*CP*CP*TP*AP*CP*GP*GP*CP*T)-3'), DNA gyrase subunit A, ... | Authors: | Bax, B.D. | Deposit date: | 2019-02-25 | Release date: | 2019-03-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.31 Å) | Cite: | Mechanistic and Structural Basis for the Actions of the Antibacterial Gepotidacin against Staphylococcus aureus Gyrase. Acs Infect Dis., 5, 2019
|
|
8YB6
| Type I-EHNH Cascade complex | Descriptor: | 61-nt crRNA, CRISPR system Cascade subunit CasC, CRISPR system Cascade subunit CasD, ... | Authors: | Li, Z. | Deposit date: | 2024-02-11 | Release date: | 2024-07-31 | Last modified: | 2024-09-11 | Method: | ELECTRON MICROSCOPY (3.06 Å) | Cite: | Mechanisms for HNH-mediated target DNA cleavage in type I CRISPR-Cas systems. Mol.Cell, 84, 2024
|
|
8FF5
| |
8YH9
| Type I-FHNH Cascade complex | Descriptor: | 60-nt crRNA, Cas5f, Cas6f, ... | Authors: | Li, Z. | Deposit date: | 2024-02-27 | Release date: | 2024-07-31 | Last modified: | 2024-09-11 | Method: | ELECTRON MICROSCOPY (3.35 Å) | Cite: | Mechanisms for HNH-mediated target DNA cleavage in type I CRISPR-Cas systems. Mol.Cell, 84, 2024
|
|
8FTK
| Chaetomium thermophilum SETX (Full-length) | Descriptor: | 5'-3' RNA helicase-like protein | Authors: | Williams, R.S, Appel, C.D. | Deposit date: | 2023-01-12 | Release date: | 2023-10-25 | Last modified: | 2023-11-01 | Method: | ELECTRON MICROSCOPY (4.56 Å) | Cite: | Sen1 architecture: RNA-DNA hybrid resolution, autoregulation, and insights into SETX inactivation in AOA2. Mol.Cell, 83, 2023
|
|
8IP0
| Cryo-EM structure of type I-B Cascade bound to a PAM-containing dsDNA target at 3.6 angstrom resolution | Descriptor: | CRISPR associated protein Cas11b, DNA (41-MER), DNA (5'-D(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'), ... | Authors: | Xiao, Y, Lu, M, Yu, C, Zhang, Y. | Deposit date: | 2023-03-13 | Release date: | 2024-03-20 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Structure and genome editing of type I-B CRISPR-Cas. Nat Commun, 15, 2024
|
|
1D8Y
| CRYSTAL STRUCTURE OF THE COMPLEX OF DNA POLYMERASE I KLENOW FRAGMENT WITH DNA | Descriptor: | D(T)19 OLIGOMER, DNA POLYMERASE I, SULFATE ION, ... | Authors: | Teplova, M, Wallace, S.T, Tereshko, V, Minasov, G, Simons, A.M, Cook, P.D, Manoharan, M, Egli, M. | Deposit date: | 1999-10-26 | Release date: | 1999-12-02 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.08 Å) | Cite: | Structural origins of the exonuclease resistance of a zwitterionic RNA. Proc.Natl.Acad.Sci.USA, 96, 1999
|
|
1H1J
| |
1D9D
| CRYSTALL STRUCTURE OF THE COMPLEX OF DNA POLYMERASE I KLENOW FRAGMENT WITH SHORT DNA FRAGMENT CARRYING 2'-0-AMINOPROPYL-RNA MODIFICATIONS 5'-D(TCG)-AP(AUC)-3' | Descriptor: | 5'-D(*TP*CP*GP)-R(AP*(U31)P*(C31))-3', DNA POLYMERASE I, MAGNESIUM ION, ... | Authors: | Teplova, M, Wallace, S.T, Tereshko, V, Minasov, G, Simons, A.M, Cook, P.D, Manoharan, M, Egli, M. | Deposit date: | 1999-10-27 | Release date: | 1999-12-02 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.18 Å) | Cite: | Structural origins of the exonuclease resistance of a zwitterionic RNA. Proc.Natl.Acad.Sci.USA, 96, 1999
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
3G91
| 1.2 Angstrom structure of the exonuclease III homologue Mth0212 | Descriptor: | DI(HYDROXYETHYL)ETHER, Exodeoxyribonuclease, GLYCEROL, ... | Authors: | Lakomek, K, Dickmanns, A, Ficner, R. | Deposit date: | 2009-02-12 | Release date: | 2010-03-09 | Last modified: | 2024-08-14 | Method: | X-RAY DIFFRACTION (1.23 Å) | Cite: | Crystal Structure Analysis of DNA Uridine Endonuclease Mth212 Bound to DNA. J.Mol.Biol., 399, 2010
|
|
6ZNS
| Crystal Structure of DUF1998 helicase MrfA | Descriptor: | Uncharacterized ATP-dependent helicase YprA, ZINC ION | Authors: | Roske, J.J, Liu, S, Loll, B, Neu, U, Wahl, M.C. | Deposit date: | 2020-07-06 | Release date: | 2020-11-25 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (3.32 Å) | Cite: | A skipping rope translocation mechanism in a widespread family of DNA repair helicases. Nucleic Acids Res., 49, 2021
|
|
2CRG
| |
4C3G
| cryo-EM structure of activated and oligomeric restriction endonuclease SgrAI | Descriptor: | 5'-D(*CP*CP*GP*GP*TP*GP*TP*GP*AP*AP*GP*AP*CP*CP *CP*AP*CP*GP*CP*AP*TP*CP)-3', 5'-D(*GP*AP*TP*GP*CP*GP*TP*GP*GP*GP*TP*CP*TP*TP *CP*AP*CP*AP)-3', SGRAIR RESTRICTION ENZYME | Authors: | Lyumkis, D, Talley, H, Stewart, A, Shah, S, Park, C.K, Tama, F, Potter, C.S, Carragher, B, Horton, N.C. | Deposit date: | 2013-08-23 | Release date: | 2013-09-11 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (8.6 Å) | Cite: | Allosteric Regulation of DNA Cleavage and Sequence-Specificity Through Run-on Oligomerization. Structure, 21, 2013
|
|
6A59
| Structure of histone demethylase REF6 at 1.8A | Descriptor: | Lysine-specific demethylase REF6, ZINC ION | Authors: | Tian, Z, Chen, Z. | Deposit date: | 2018-06-22 | Release date: | 2019-06-26 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.82 Å) | Cite: | Crystal structures of REF6 and its complex with DNA reveal diverse recognition mechanisms. Cell Discov, 6, 2020
|
|
1P7A
| Solution Structure of the Third Zinc Finger from BKLF | Descriptor: | Kruppel-like factor 3, ZINC ION | Authors: | Simpson, R.J.Y, Cram, E.D, Czolij, R, Matthews, J.M, Crossley, M, Mackay, J.P. | Deposit date: | 2003-04-30 | Release date: | 2003-12-30 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | CCHX zinc finger derivatives retain the ability to bind Zn(II) and mediate protein-DNA interactions. J.Biol.Chem., 278, 2003
|
|
7ABM
| X-ray structure of phosphorylated Barrier-to-autointegration factor (BAF) | Descriptor: | Barrier-to-autointegration factor, CESIUM ION | Authors: | Zinn-Justin, S, Marcelot, A, Le Du, M.H, Ropars, V. | Deposit date: | 2020-09-08 | Release date: | 2021-07-07 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (3.004 Å) | Cite: | Di-phosphorylated BAF shows altered structural dynamics and binding to DNA, but interacts with its nuclear envelope partners. Nucleic Acids Res., 49, 2021
|
|
6LTV
| Crystal Structure of I122A/I330A variant of S-adenosylmethionine synthetase from Cryptosporidium hominis in complex with ONB-SAM (2-nitro benzyme S-adenosyl-methionine) | Descriptor: | MAGNESIUM ION, S-adenosylmethionine synthase, TRIPHOSPHATE, ... | Authors: | Singh, R.K, Michailidou, F, Rentmeister, A, Kuemmel, D. | Deposit date: | 2020-01-23 | Release date: | 2020-10-21 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (1.87 Å) | Cite: | Engineered SAM Synthetases for Enzymatic Generation of AdoMet Analogs with Photocaging Groups and Reversible DNA Modification in Cascade Reactions. Angew.Chem.Int.Ed.Engl., 60, 2021
|
|
6LTW
| Crystal structure of Apo form of I122A/I330A variant of S-adenosylmethionine synthetase from Cryptosporidium hominis | Descriptor: | MAGNESIUM ION, PHOSPHATE ION, S-adenosylmethionine synthase | Authors: | Singh, R.K, Michailidou, F, Rentmeister, A, Kuemmel, D. | Deposit date: | 2020-01-23 | Release date: | 2020-10-21 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Engineered SAM Synthetases for Enzymatic Generation of AdoMet Analogs with Photocaging Groups and Reversible DNA Modification in Cascade Reactions. Angew.Chem.Int.Ed.Engl., 60, 2021
|
|
7AHX
| HIV-1 REVERSE TRANSCRIPTASE COMPLEX WITH DNA AND D-ASPARTATE TENOFOVIR WITH BOUND MANGANESE | Descriptor: | D-Aspartate Tenofovir, DNA (5'-D(*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG)*CP*GP*CP*CP*(DDG))-3'), DNA (5'-D(*TP*GP*GP*TP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*TP*G)-3'), ... | Authors: | Gu, W, Martinez, S.E, Nguyen, H, Xu, H, Herdewijn, P, de Jonghe, S, Das, K. | Deposit date: | 2020-09-25 | Release date: | 2021-01-13 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.73 Å) | Cite: | Tenofovir-Amino Acid Conjugates Act as Polymerase Substrates-Implications for Avoiding Cellular Phosphorylation in the Discovery of Nucleotide Analogues. J.Med.Chem., 64, 2021
|
|
5CAJ
| Crystal structure of E. coli YaaA, a member of the DUF328/UPF0246 family | Descriptor: | BENZAMIDINE, CHLORIDE ION, UPF0246 protein YaaA | Authors: | Prahlad, J, Lin, J, Wilson, M.A. | Deposit date: | 2015-06-29 | Release date: | 2016-02-24 | Last modified: | 2020-10-28 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | The DUF328 family member YaaA is a DNA-binding protein with a novel fold. J.Biol.Chem., 295, 2020
|
|