8WAW
| De novo transcribing complex 13 (TC13), the early elongation complex with Pol II positioned 13nt downstream of TSS | Descriptor: | Alpha-amanitin, DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | Authors: | Chen, X, Liu, W, Wang, Q, Wang, X, Ren, Y, Qu, X, Li, W, Xu, Y. | Deposit date: | 2023-09-08 | Release date: | 2023-12-06 | Last modified: | 2024-01-03 | Method: | ELECTRON MICROSCOPY (3.02 Å) | Cite: | Structural visualization of transcription initiation in action. Science, 382, 2023
|
|
5DAT
| Complex of yeast 80S ribosome with hypusine-containing eIF5A | Descriptor: | 18S ribosomal RNA, 25S ribosomal RNA, 40S ribosomal protein S0-A, ... | Authors: | Melnikov, S, Mailliot, J, Shin, B.-S, Rigger, L, Yusupova, G, Micura, R, Dever, T.E, Yusupov, M. | Deposit date: | 2015-08-20 | Release date: | 2016-08-31 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | Coping with proline stalling: structural basis of hypusine-induced protein synthesis by the eukaryotic ribosome To Be Published
|
|
8UKR
| RNA polymerase II elongation complex with Fapy-dG lesion soaking with ATP before chemistry | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase II subunit RPB1, DNA-directed RNA polymerase II subunit RPB11, ... | Authors: | Hou, P, Oh, J, Wang, D. | Deposit date: | 2023-10-15 | Release date: | 2024-04-24 | Method: | X-RAY DIFFRACTION (3.78 Å) | Cite: | Molecular Mechanism of RNA Polymerase II Transcriptional Mutagenesis by the Epimerizable DNA Lesion, Fapy·dG. J.Am.Chem.Soc., 146, 2024
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
5TLA
| |
3V3N
| Crystal structure of TetX2 T280A: an adaptive mutant in complex with minocycline | Descriptor: | (4S,4AS,5AR,12AS)-4,7-BIS(DIMETHYLAMINO)-3,10,12,12A-TETRAHYDROXY-1,11-DIOXO-1,4,4A,5,5A,6,11,12A-OCTAHYDROTETRACENE-2- CARBOXAMIDE, FLAVIN-ADENINE DINUCLEOTIDE, SULFATE ION, ... | Authors: | Walkiewicz, K, Shamoo, Y. | Deposit date: | 2011-12-13 | Release date: | 2013-01-02 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.703 Å) | Cite: | Crystal structure of TetX2 T280A: an adaptive mutant in complex with minocycline To be Published
|
|
7CCR
| Structure of the 2:2 cGAS-nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, DNA (147-MER), Histone H2A type 1-B/E, ... | Authors: | Cao, D, Han, X, Fan, X, Xu, R.M, Zhang, X. | Deposit date: | 2020-06-17 | Release date: | 2020-10-07 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (4.9 Å) | Cite: | Structural basis for nucleosome-mediated inhibition of cGAS activity. Cell Res., 30, 2020
|
|
5YOY
| Crystal structure of the human tumor necrosis factor in complex with golimumab Fv | Descriptor: | Golimumab heavy chain variable region, Golimumab light chain variable region, Tumor necrosis factor | Authors: | Ono, M, Horita, S, Sato, Y, Nomura, Y, Iwata, S, Nomura, N. | Deposit date: | 2017-10-31 | Release date: | 2018-05-09 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.727 Å) | Cite: | Structural basis for tumor necrosis factor blockade with the therapeutic antibody golimumab Protein Sci., 27, 2018
|
|
6GMH
| Structure of activated transcription complex Pol II-DSIF-PAF-SPT6 | Descriptor: | CDC73, CTR9,RNA polymerase-associated protein CTR9 homolog,RNA polymerase-associated protein CTR9 homolog, DNA-directed RNA polymerase II subunit RPB9, ... | Authors: | Vos, S.M, Farnung, L, Boehing, M, Linden, A, Wigge, C, Urlaub, H, Cramer, P. | Deposit date: | 2018-05-26 | Release date: | 2018-08-22 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structure of activated transcription complex Pol II-DSIF-PAF-SPT6. Nature, 560, 2018
|
|
6GYM
| Structure of a yeast closed complex with distorted DNA (CCdist) | Descriptor: | DNA-directed RNA polymerase II subunit RPB1, DNA-directed RNA polymerase II subunit RPB11, DNA-directed RNA polymerase II subunit RPB2, ... | Authors: | Dienemann, C, Schwalb, B, Schilbach, S, Cramer, P. | Deposit date: | 2018-06-30 | Release date: | 2018-12-05 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (6.7 Å) | Cite: | Promoter Distortion and Opening in the RNA Polymerase II Cleft. Mol. Cell, 73, 2019
|
|
8JCH
| |
6GYL
| Structure of a yeast closed complex with distorted DNA (core CCdist) | Descriptor: | DNA-directed RNA polymerase II subunit RPB1, DNA-directed RNA polymerase II subunit RPB11, DNA-directed RNA polymerase II subunit RPB2, ... | Authors: | Dienemann, C, Schwalb, B, Schilbach, S, Cramer, P. | Deposit date: | 2018-06-30 | Release date: | 2018-12-05 | Last modified: | 2019-12-11 | Method: | ELECTRON MICROSCOPY (4.8 Å) | Cite: | Promoter Distortion and Opening in the RNA Polymerase II Cleft. Mol. Cell, 73, 2019
|
|
7UNC
| Pol II-DSIF-SPT6-PAF1c-TFIIS complex with rewrapped nucleosome | Descriptor: | DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit RPB3, DNA-directed RNA polymerase II subunit RPB7, ... | Authors: | Filipovski, M, Vos, S.M, Farnung, L. | Deposit date: | 2022-04-10 | Release date: | 2022-10-19 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Structural basis of nucleosome retention during transcription elongation. Science, 376, 2022
|
|
6GYK
| Structure of a yeast closed complex (core CC1) | Descriptor: | DNA-directed RNA polymerase II subunit RPB1, DNA-directed RNA polymerase II subunit RPB11, DNA-directed RNA polymerase II subunit RPB2, ... | Authors: | Dienemann, C, Schwalb, B, Schilbach, S, Cramer, P. | Deposit date: | 2018-06-30 | Release date: | 2018-12-05 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (5.1 Å) | Cite: | Promoter Distortion and Opening in the RNA Polymerase II Cleft. Mol. Cell, 73, 2019
|
|
6GML
| Structure of paused transcription complex Pol II-DSIF-NELF | Descriptor: | DNA-directed RNA polymerase II subunit RPB9, DNA-directed RNA polymerase subunit, DNA-directed RNA polymerase subunit beta, ... | Authors: | Vos, S.M, Farnung, L, Urlaub, H, Cramer, P. | Deposit date: | 2018-05-27 | Release date: | 2018-09-05 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Structure of paused transcription complex Pol II-DSIF-NELF. Nature, 560, 2018
|
|
6AWB
| Structure of 30S ribosomal subunit and RNA polymerase complex in non-rotated state | Descriptor: | 16S rRNA, 30S ribosomal protein S1, 30S ribosomal protein S10, ... | Authors: | Demo, G, Rasouly, A, Vasilyev, N, Loveland, A.B, Diaz-Avalos, R, Grigorieff, N, Nudler, E, Korostelev, A.A. | Deposit date: | 2017-09-05 | Release date: | 2017-10-18 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (6.7 Å) | Cite: | Structure of RNA polymerase bound to ribosomal 30S subunit. Elife, 6, 2017
|
|
7EDX
| p53-bound TFIID-based core PIC on HDM2 promoter | Descriptor: | DNA (84-mer), DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | Authors: | Chen, X, Qi, Y, Hou, H, Wang, X, Wu, Z, Li, J, Xu, Y. | Deposit date: | 2021-03-17 | Release date: | 2021-05-05 | Last modified: | 2021-05-19 | Method: | ELECTRON MICROSCOPY (4.5 Å) | Cite: | Structural insights into preinitiation complex assembly on core promoters. Science, 372, 2021
|
|
7EG7
| TFIID-based core PIC on SCP promoter | Descriptor: | DNA (79-MER), DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | Authors: | Chen, X, Qi, Y, Hou, H, Wang, X, Wu, Z, Li, J, Xu, Y. | Deposit date: | 2021-03-24 | Release date: | 2021-05-05 | Last modified: | 2021-05-19 | Method: | ELECTRON MICROSCOPY (6.2 Å) | Cite: | Structural insights into preinitiation complex assembly on core promoters. Science, 372, 2021
|
|
7EG9
| TFIID-based intermediate PIC on SCP promoter | Descriptor: | DNA (79-MER), DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | Authors: | Chen, X, Qi, Y, Wang, X, Wu, Z, Li, J, Xu, Y. | Deposit date: | 2021-03-24 | Release date: | 2021-05-05 | Last modified: | 2021-05-19 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Structural insights into preinitiation complex assembly on core promoters. Science, 372, 2021
|
|
6AWD
| Structure of 30S (S1 depleted) ribosomal subunit and RNA polymerase complex | Descriptor: | 16S rRNA, 30S ribosomal protein S10, 30S ribosomal protein S11, ... | Authors: | Demo, G, Rasouly, A, Vasilyev, N, Loveland, A.B, Diaz-Avalos, R, Grigorieff, N, Nudler, E, Korostelev, A.A. | Deposit date: | 2017-09-05 | Release date: | 2017-10-18 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (8.1 Å) | Cite: | Structure of RNA polymerase bound to ribosomal 30S subunit. Elife, 6, 2017
|
|
6GQ1
| Cryo-EM reconstruction of yeast 80S ribosome in complex with mRNA, tRNA and eEF2 (GMPPCP/sordarin) | Descriptor: | 18S ribosomal RNA, 40S ribosomal protein S0-A, 40S ribosomal protein S1-A, ... | Authors: | Pellegrino, S, Demeshkina, N, Mancera-Martinez, E, Melnikov, S, Simonetti, A, Myasnikov, A, Yusupov, M, Yusupova, G, Hashem, Y. | Deposit date: | 2018-06-07 | Release date: | 2018-07-11 | Last modified: | 2018-08-08 | Method: | ELECTRON MICROSCOPY (4.4 Å) | Cite: | Structural Insights into the Role of Diphthamide on Elongation Factor 2 in mRNA Reading-Frame Maintenance. J. Mol. Biol., 430, 2018
|
|
6AWC
| Structure of 30S ribosomal subunit and RNA polymerase complex in rotated state | Descriptor: | 16S rRNA, 30S ribosomal protein S1, 30S ribosomal protein S10, ... | Authors: | Demo, G, Rasouly, A, Vasilyev, N, Loveland, A.B, Diaz-Avalos, R, Grigorieff, N, Nudler, E, Korostelev, A.A. | Deposit date: | 2017-09-05 | Release date: | 2017-10-18 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (7.9 Å) | Cite: | Structure of RNA polymerase bound to ribosomal 30S subunit. Elife, 6, 2017
|
|
7AS5
| 126 helix bundle DNA nanostructure | Descriptor: | SCAFFOLD STRAND, STAPLE STRAND | Authors: | Kube, M, Kohler, F, Feigl, E, Nagel-Yuksel, B, Willner, E.M, Funke, J.J, Gerling, T, Stommer, P, Honemann, M.N, Martin, T.G, Scheres, S.H.W, Dietz, H. | Deposit date: | 2020-10-27 | Release date: | 2020-11-18 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (9.8 Å) | Cite: | Revealing the structures of megadalton-scale DNA complexes with nucleotide resolution. Nat Commun, 11, 2020
|
|
8K5P
| |
6AH0
| The Cryo-EM Structure of the Precusor of Human Pre-catalytic Spliceosome (pre-B complex) | Descriptor: | 116 kDa U5 small nuclear ribonucleoprotein component, GUANOSINE-5'-TRIPHOSPHATE, INOSITOL HEXAKISPHOSPHATE, ... | Authors: | Zhan, X, Yan, C, Zhang, X, Shi, Y. | Deposit date: | 2018-08-15 | Release date: | 2018-11-14 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (5.7 Å) | Cite: | Structures of the human pre-catalytic spliceosome and its precursor spliceosome. Cell Res., 28, 2018
|
|