1KJF
| |
1KJG
| |
1KJH
| |
1KNA
| |
1KNE
| |
1KNO
| |
1KNV
| Bse634I restriction endonuclease | Descriptor: | ACETATE ION, Bse634I restriction endonuclease, CHLORIDE ION | Authors: | Grazulis, S, Deibert, M, Rimseliene, R, Skirgaila, R, Sasnauskas, G, Lagunavicius, A, Repin, V, Urbanke, C, Huber, R, Siksnys, V. | Deposit date: | 2001-12-19 | Release date: | 2002-02-27 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.17 Å) | Cite: | Crystal structure of the Bse634I restriction endonuclease: comparison of two enzymes recognizing the same DNA sequence. Nucleic Acids Res., 30, 2002
|
|
1KO2
| VIM-2, a Zn-beta-lactamase from Pseudomonas aeruginosa with an oxidized Cys (cysteinesulfonic) | Descriptor: | ACETATE ION, VIM-2 metallo-beta-lactamase, ZINC ION | Authors: | Garcia-Saez, I, Docquier, J.-D, Rossolini, G.M, Dideberg, O. | Deposit date: | 2001-12-20 | Release date: | 2003-09-02 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The three-dimensional structure of VIM-2, a Zn-beta-lactamase from Pseudomonas aeruginosa in its reduced and oxidised form J.Mol.Biol., 375, 2008
|
|
1KO3
| VIM-2, a Zn-beta-lactamase from Pseudomonas aeruginosa with Cys221 reduced | Descriptor: | ACETATE ION, CHLORIDE ION, HYDROXIDE ION, ... | Authors: | Garcia-Saez, I, Docquier, J.-D, Rossolini, G.M, Dideberg, O. | Deposit date: | 2001-12-20 | Release date: | 2003-09-02 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (1.91 Å) | Cite: | The three-dimensional structure of VIM-2, a Zn-beta-lactamase from Pseudomonas aeruginosa in its reduced and oxidised form J.Mol.Biol., 375, 2008
|
|
1KQC
| Structure of Nitroreductase from E. cloacae Complex with Inhibitor Acetate | Descriptor: | ACETATE ION, FLAVIN MONONUCLEOTIDE, OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE | Authors: | Haynes, C.A, Koder, R.L, Miller, A.F, Rodgers, D.W. | Deposit date: | 2002-01-04 | Release date: | 2002-02-13 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structures of nitroreductase in three states: effects of inhibitor binding and reduction. J.Biol.Chem., 277, 2002
|
|
1KR7
| Crystal structure of the nerve tissue mini-hemoglobin from the nemertean worm Cerebratulus lacteus | Descriptor: | ACETATE ION, Neural globin, OXYGEN MOLECULE, ... | Authors: | Pesce, A, Nardini, M, Dewilde, S, Geuens, E, Yamauchi, k, Ascenzi, P, Riggs, A.F, Moens, L, Bolognesi, M. | Deposit date: | 2002-01-09 | Release date: | 2002-05-15 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | The 109 residue nerve tissue minihemoglobin from Cerebratulus lacteus highlights striking structural plasticity of the alpha-helical globin fold Structure, 10, 2002
|
|
1KU5
| Crystal Structure of recombinant histone HPhA from hyperthermophilic archaeon Pyrococcus horikoshii OT3 | Descriptor: | ACETATE ION, HPhA, SULFATE ION | Authors: | Li, T, Sun, F, Ji, X, Feng, Y, Rao, Z. | Deposit date: | 2002-01-21 | Release date: | 2003-08-26 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structure based hyperthermostability of archaeal histone HPhA from Pyrococcus horikoshii J.MOL.BIOL., 325, 2003
|
|
1KWG
| Crystal structure of Thermus thermophilus A4 beta-galactosidase | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, ACETATE ION, BETA-GALACTOSIDASE, ... | Authors: | Hidaka, M, Fushinobu, S, Ohtsu, N, Motoshima, H, Matsuzawa, H, Shoun, H, Wakagi, T. | Deposit date: | 2002-01-29 | Release date: | 2002-09-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Trimeric Crystal Structure of the Glycoside Hydrolase Family 42 beta-Galactosidase from Thermus thermophilus A4 and the Structure of its Complex with Galactose J.MOL.BIOL., 322, 2002
|
|
1KWK
| Crystal structure of Thermus thermophilus A4 beta-galactosidase in complex with galactose | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, ACETATE ION, BETA-GALACTOSIDASE, ... | Authors: | Hidaka, M, Fushinobu, S, Ohtsu, N, Motoshima, H, Matsuzawa, H, Shoun, H, Wakagi, T. | Deposit date: | 2002-01-29 | Release date: | 2002-10-02 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Trimeric crystal structure of the glycoside hydrolase family 42 beta-galactosidase from Thermus thermophilus A4 and the structure of its complex with galactose. J.Mol.Biol., 322, 2002
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX9
| ANTENNAL CHEMOSENSORY PROTEIN A6 FROM THE MOTH MAMESTRA BRASSICAE | Descriptor: | ACETATE ION, CHEMOSENSORY PROTEIN A6 | Authors: | Lartigue, A, Campanacci, V, Roussel, A, Larsson, A.M, Jones, T.A, Tegoni, M, Cambillau, C. | Deposit date: | 2002-01-31 | Release date: | 2002-12-04 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | X-ray structure and ligand binding study of a moth chemosensory protein J.Biol.Chem., 277, 2002
|
|
1L0V
| Quinol-Fumarate Reductase with Menaquinol Molecules | Descriptor: | FE2/S2 (INORGANIC) CLUSTER, FE3-S4 CLUSTER, FLAVIN-ADENINE DINUCLEOTIDE, ... | Authors: | Iverson, T.M, Luna-Chavez, C, Croal, L.R, Cecchini, G, Rees, D.C. | Deposit date: | 2002-02-13 | Release date: | 2002-03-13 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Crystallographic studies of the Escherichia coli quinol-fumarate reductase with inhibitors bound to the quinol-binding site. J.Biol.Chem., 277, 2002
|
|
1L5J
| CRYSTAL STRUCTURE OF E. COLI ACONITASE B. | Descriptor: | ACONITATE ION, Aconitate hydratase 2, FE3-S4 CLUSTER | Authors: | Williams, C.H, Stillman, T.J, Barynin, V.V, Sedelnikova, S.E, Tang, Y, Green, J, Guest, J.R, Artymiuk, P.J. | Deposit date: | 2002-03-07 | Release date: | 2002-06-12 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | E. coli aconitase B structure reveals a HEAT-like domain with implications for protein-protein recognition. Nat.Struct.Biol., 9, 2002
|
|
1L6R
| Crystal Structure of Thermoplasma acidophilum 0175 (APC0014) | Descriptor: | CALCIUM ION, FORMIC ACID, HYPOTHETICAL PROTEIN TA0175 | Authors: | Kim, Y, Joachimiak, A, Edwards, A.M, Xu, X, Pennycooke, M, Gu, J, Cheung, F, Christendat, D, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2002-03-13 | Release date: | 2003-01-21 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Structure- and function-based characterization of a new phosphoglycolate phosphatase from Thermoplasma acidophilum. J.Biol.Chem., 279, 2004
|
|
1L8S
| |
1L9A
| CRYSTAL STRUCTURE OF SRP19 IN COMPLEX WITH THE S DOMAIN OF SIGNAL RECOGNITION PARTICLE RNA | Descriptor: | MAGNESIUM ION, METHYL MERCURY ION, SIGNAL RECOGNITION PARTICLE 19 KDA PROTEIN, ... | Authors: | Oubridge, C, Kuglstatter, A, Jovine, L, Nagai, K. | Deposit date: | 2002-03-22 | Release date: | 2002-06-28 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of SRP19 in complex with the S domain of SRP RNA and its implication for the assembly of the signal recognition particle. Mol.Cell, 9, 2002
|
|
1LDG
| PLASMODIUM FALCIPARUM L-LACTATE DEHYDROGENASE COMPLEXED WITH NADH AND OXAMATE | Descriptor: | 1,4-DIHYDRONICOTINAMIDE ADENINE DINUCLEOTIDE, L-LACTATE DEHYDROGENASE, OXAMIC ACID | Authors: | Dunn, C, Banfield, M, Barker, J, Higham, C, Moreton, K, Turgut-Balik, D, Brady, L, Holbrook, J.J. | Deposit date: | 1996-09-10 | Release date: | 1997-09-17 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.74 Å) | Cite: | The structure of lactate dehydrogenase from Plasmodium falciparum reveals a new target for anti-malarial design. Nat.Struct.Biol., 3, 1996
|
|
1LDM
| |