1M18
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1m18 by Molmil](/molmil-images/mine/1m18) | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|
3LZ0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lz0 by Molmil](/molmil-images/mine/3lz0) | Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 1) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3LZ1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lz1 by Molmil](/molmil-images/mine/3lz1) | Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 2) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3REH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3reh by Molmil](/molmil-images/mine/3reh) | |
6GYT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6gyt by Molmil](/molmil-images/mine/6gyt) | |
7OHC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ohc by Molmil](/molmil-images/mine/7ohc) | |
3MNN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mnn by Molmil](/molmil-images/mine/3mnn) | A Ruthenium Antitumour Agent Forms Specific Histone Protein Adducts in the Nucleosome Core | Descriptor: | 1,3,5-triaza-7-phosphatricyclo[3.3.1.1~3,7~]decane, 1-methyl-4-(1-methylethyl)benzene, DNA (145-MER), ... | Authors: | Ong, M.S, Davey, C.A. | Deposit date: | 2010-04-22 | Release date: | 2011-04-06 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | A ruthenium antimetastasis agent forms specific histone protein adducts in the nucleosome core Chemistry, 17, 2011
|
|
6ZHX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6zhx by Molmil](/molmil-images/mine/6zhx) | Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: nucleosome class. | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (145-MER) Widom 601 sequence, Histone H2A type 1, ... | Authors: | Bacic, L, Gaullier, G, Croll, T.I, Deindl, S. | Deposit date: | 2020-06-24 | Release date: | 2020-12-23 | Last modified: | 2021-07-14 | Method: | ELECTRON MICROSCOPY (2.5 Å) | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch. Cell Rep, 33, 2020
|
|
4Z66
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4z66 by Molmil](/molmil-images/mine/4z66) | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-04-03 | Release date: | 2015-10-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
3REJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rej by Molmil](/molmil-images/mine/3rej) | |
8CZE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cze by Molmil](/molmil-images/mine/8cze) | Structure of a Xenopus Nucleosome with Widom 601 DNA | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Gu, Y, Ur, S.N, Milano, C.R, Tromer, E.C, Vale-Silva, L.A, Hochwagen, A, Corbett, K.D. | Deposit date: | 2022-05-24 | Release date: | 2023-06-07 | Last modified: | 2024-04-10 | Method: | ELECTRON MICROSCOPY (2.58 Å) | Cite: | Chromatin binding by HORMAD proteins regulates meiotic recombination initiation. Embo J., 43, 2024
|
|
4J8V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4j8v by Molmil](/molmil-images/mine/4j8v) | |
5CP6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cp6 by Molmil](/molmil-images/mine/5cp6) | Nucleosome Core Particle with Adducts from the Anticancer Compound, [(eta6-5,8,9,10-tetrahydroanthracene)Ru(ethylenediamine)Cl][PF6] | Descriptor: | (ethane6-5,8,9,10-tetrahydroanthracene)Ru(II)(ethylene-diamine)Cl, DNA (145-MER), Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2015-07-21 | Release date: | 2016-06-01 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | An Organometallic Compound which Exhibits a DNA Topology-Dependent One-Stranded Intercalation Mode. Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
3REK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rek by Molmil](/molmil-images/mine/3rek) | |
7SWY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7swy by Molmil](/molmil-images/mine/7swy) | 2.6 A structure of a 40-601[TA-rich+1]-40 nucleosome | Descriptor: | DNA Guide Strand, DNA Tracking Strand, Histone H2A, ... | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | Deposit date: | 2021-11-21 | Release date: | 2022-03-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (2.6 Å) | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
|
|
4WU9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wu9 by Molmil](/molmil-images/mine/4wu9) | Structure of cisPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
8T9F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8t9f by Molmil](/molmil-images/mine/8t9f) | |
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
5XF6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf6 by Molmil](/molmil-images/mine/5xf6) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5F99
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5f99 by Molmil](/molmil-images/mine/5f99) | |
3REI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3rei by Molmil](/molmil-images/mine/3rei) | |
3MGQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mgq by Molmil](/molmil-images/mine/3mgq) | Binding of Nickel ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
2NZD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2nzd by Molmil](/molmil-images/mine/2nzd) | Nucleosome core particle containing 145 bp of DNA | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | Deposit date: | 2006-11-23 | Release date: | 2007-04-10 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | DNA stretching and extreme kinking in the nucleosome core J.Mol.Biol., 368, 2007
|
|
1M1A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1m1a by Molmil](/molmil-images/mine/1m1a) | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.MOL.BIOL., 326, 2003
|
|
8PEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8peo by Molmil](/molmil-images/mine/8peo) | H3K36me2 nucleosome-LEDGF/p75 PWWP domain complex | Descriptor: | (2R)-2-amino-3-(2-dimethylaminoethylsulfanyl)propanoic acid, Histone H2A, Histone H2B 1.1, ... | Authors: | Koutna, E, Kouba, T, Veverka, V. | Deposit date: | 2023-06-14 | Release date: | 2023-08-16 | Last modified: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (2.69 Å) | Cite: | Multivalency of nucleosome recognition by LEDGF. Nucleic Acids Res., 51, 2023
|
|