PDB: 20558 resultsInfo pagesStatus searchChemie searchBIRD

---

2IKE	Solution Structure of the second Clip domain in PAP2 Descriptor: Prophenoloxidase activating proteinase-2 Authors: Huang, R.D, Lv, Z.Q, Dai, H.E, Velde, D.V, Prakash, O, Jiang, H.B. Deposit date: 2006-10-02 Release date: 2007-10-16 Last modified: 2022-03-09 Method: SOLUTION NMR Cite: Solution structure of Clip domain in PAP2 To be Published
2O3M	Monomeric G-DNA tetraplex from human C-kit promoter Descriptor: 5'-D(*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*CP*TP*GP*GP*GP*AP*GP*GP*AP*GP*GP*G)-3' Authors: Phan, A.T, Kuryavyi, V.V, Burge, S, Neidle, S, Patel, D.J. Deposit date: 2006-12-01 Release date: 2007-05-22 Last modified: 2023-12-27 Method: SOLUTION NMR Cite: Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter. J.Am.Chem.Soc., 129, 2007
2G46	structure of vSET in complex with meK27 H3 Pept. and cofactor product SAH Descriptor: PBCV-1 histone H3-Lys 27 methyltransferase, S-ADENOSYL-L-HOMOCYSTEINE, meK27 H3 Peptide Authors: Qian, C.M, Zheng, L, Zhou, M.M. Deposit date: 2006-02-21 Release date: 2006-12-05 Last modified: 2022-03-09 Method: SOLUTION NMR Cite: Structural insights of the specificity and catalysis of a viral histone H3 lysine 27 methyltransferase. J.Mol.Biol., 359, 2006
2PJF	Solution structure of rhodostomin Descriptor: Rhodostoxin-disintegrin rhodostomin Authors: Chuang, W.J, Chen, Y.C, Chen, C.Y, Chang, Y.T. Deposit date: 2007-04-16 Release date: 2007-05-08 Last modified: 2022-03-16 Method: SOLUTION NMR Cite: Effect of D to E mutation of the RGD motif in rhodostomin on its activity, structure, and dynamics: Importance of the interactions between the D residue and integrin Proteins, 2009
2GQI	Solution structure of the SH3 domain of human Ras GTPase-activating protein 1 Descriptor: Ras GTPase-activating protein 1 Authors: Kurosaki, C, Hayashi, F, Yoshida, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2006-04-21 Release date: 2006-10-21 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Solution structure of the SH3 domain of human Ras GTPase-activating protein 1 To be Published
2EQL	CRYSTALLOGRAPHIC STUDIES OF A CALCIUM BINDING LYSOZYME FROM EQUINE MILK AT 2.5 ANGSTROMS RESOLUTION Descriptor: HORSE MILK LYSOZYME Authors: Tsuge, H, Ago, H, Miyano, M. Deposit date: 1994-05-27 Release date: 1994-07-31 Last modified: 2017-11-29 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystallographic studies of a calcium binding lysozyme from equine milk at 2.5 A resolution. J.Biochem.(Tokyo), 111, 1992
2GQJ	Solution structure of the two zf-C2H2 like domains(493-575) of human zinc finger protein KIAA1196 Descriptor: ZINC ION, Zinc finger protein KIAA1196 Authors: Kurosaki, C, Hayashi, F, Yoshida, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2006-04-21 Release date: 2006-10-21 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Solution structure of the two zf-C2H2 like domains(493-575) of human zinc finger protein KIAA1196 To be Published
2KWJ	Solution structures of the double PHD fingers of human transcriptional protein DPF3 bound to a histone peptide containing acetylation at lysine 14 Descriptor: Histone peptide, ZINC ION, Zinc finger protein DPF3 Authors: Zeng, L, Zhang, Q, Li, S, Plotnikov, A.N, Walsh, M.J, Zhou, M. Deposit date: 2010-04-12 Release date: 2010-07-14 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Mechanism and regulation of acetylated histone binding by the tandem PHD finger of DPF3b. Nature, 466, 2010
2GQH	Solution structure of the 15th Ig-like domain of human KIAA1556 protein Descriptor: KIAA1556 protein Authors: Kurosaki, C, Hayashi, F, Yoshida, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2006-04-21 Release date: 2006-10-21 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Solution structure of the 15th Ig-like domain of human KIAA1556 protein To be Published
2KWK	Solution structures of the double PHD fingers of human transcriptional protein DPF3b bound to a H3 peptide wild type Descriptor: Histone peptide, ZINC ION, Zinc finger protein DPF3 Authors: Zeng, L, Zhang, Q, Li, S, Plotnikov, A.N, Walsh, M.J, Zhou, M. Deposit date: 2010-04-12 Release date: 2010-07-14 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Mechanism and regulation of acetylated histone binding by the tandem PHD finger of DPF3b. Nature, 466, 2010
2QH2	Solution structure of the CR7 terminal hairpin loop from human telomerase RNA Descriptor: Human telomerase RNA CR7 terminal hairpin loop Authors: Feigon, J, Theimer, C.A, Chim, N, Breece, K.E. Deposit date: 2007-06-29 Release date: 2007-09-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural and functional characterization of human telomerase RNA processing and cajal body localization signals. Mol.Cell, 27, 2007
2QH3	Solution structure of the U64 H/ACA snoRNA 3' terminal hairpin loop Descriptor: Human U64 H/ACA snoRNA Authors: Feigon, J, Theimer, C.A, Chim, N, Breece, K.E. Deposit date: 2007-06-29 Release date: 2007-09-25 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural and functional characterization of human telomerase RNA processing and cajal body localization signals. Mol.Cell, 27, 2007
2P89	Solution structure of the 3' pseudouridyation pocket of U65 snoRNA with bound substrate Descriptor: 28S rRNA, U65 H/ACA snoRNA Authors: Wu, H, Feigon, J. Deposit date: 2007-03-22 Release date: 2007-04-03 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: H/ACA small nucleolar RNA pseudouridylation pockets bind substrate RNA to form three-way junctions that position the target U for modification. Proc.Natl.Acad.Sci.Usa, 104, 2007
2OX2	Structure of the cantionic, antimicrobial hexapeptide cyclo(RRWWFR) bound to DPC-micelles Descriptor: cRW2 peptide Authors: Appelt, C, Wessolowski, A, Soderhall, J.A, Dathe, M, Schmieder, P. Deposit date: 2007-02-19 Release date: 2007-12-25 Last modified: 2022-03-16 Method: SOLUTION NMR Cite: Structures of cyclic, antimicrobial peptides in a membrane-mimicking environment define requirements for activity. J.Pept.Sci., 14, 2007
2JW6	Solution structure of the DEAF1 MYND domain Descriptor: Deformed epidermal autoregulatory factor 1 homolog, ZINC ION Authors: Spadaccini, R, Perrin, H, Bottomley, M, Ansieu, S, Sattler, M. Deposit date: 2007-10-08 Release date: 2007-12-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Retraction notice to "Structure and functional analysis of the MYND domain" [J. Mol. Biol. (2006) 358, 498-508]. J.Mol.Biol., 376, 2008
2QH4	Solution structure of the U85 C/D-H/ACA scaRNA 5' terminal hairpin loop Descriptor: Human U85 C/D-H/ACA scaRNA Authors: Feigon, J, Theimer, C.A, Chim, N, Breece, K.E. Deposit date: 2007-06-29 Release date: 2007-09-25 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural and functional characterization of human telomerase RNA processing and cajal body localization signals. Mol.Cell, 27, 2007
2M5Q	Solution structure of lipidated glucagon analog in d-TFE Descriptor: GAMMA-L-GLUTAMIC ACID, Glucagon, PALMITIC ACID Authors: Ward, B.P, Ma, D. Deposit date: 2013-03-04 Release date: 2013-03-27 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Structural Changes Associated with Peptide Lipidation Broaden Biological Function To be Published
2MD2	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects Descriptor: Lactotransferrin Authors: Bhunia, A, Chatterjee, S, Ghosh, A, Jana, J. Deposit date: 2013-08-29 Release date: 2013-09-25 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Sequence context induced antimicrobial activity: insight into lipopolysaccharide permeabilization. Mol Biosyst, 10, 2014
2ME8	Solution Structure of BCL-xL in its p53-bound conformation determined with selective isotope labelling of I,L,V sidechains Descriptor: Bcl-2-like protein 1 Authors: Viacava Follis, A, Grace, C.R, Kriwacki, R.W. Deposit date: 2013-09-25 Release date: 2014-04-30 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: The DNA-binding domain mediates both nuclear and cytosolic functions of p53. Nat.Struct.Mol.Biol., 21, 2014
2M58	Structure of 2'-5' AG1 lariat forming ribozyme in its inactive state Descriptor: RNA (59-MER) Authors: Carlomagno, T, Amata, I, Codutti, L, Falb, M, Fohrer, J, Simon, B. Deposit date: 2013-02-18 Release date: 2013-04-03 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural principles of RNA catalysis in a 2'-5' lariat-forming ribozyme. J.Am.Chem.Soc., 135, 2013
2M92	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid Descriptor: 34-MER DNA Authors: Lim, K.W, Phan, A.T. Deposit date: 2013-05-30 Release date: 2013-07-10 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural basis of DNA quadruplex-duplex junction formation. Angew.Chem.Int.Ed.Engl., 52, 2013
2M1H	Solution structure of a PWWP domain from Trypanosoma brucei Descriptor: Transcription elongation factor S-II Authors: Wang, R, Fan, K, Liao, S, Zhang, J, Tu, X. Deposit date: 2012-11-28 Release date: 2013-12-04 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution structure of TbTFIIS2-1 PWWP domain from Trypanosoma brucei. Proteins, 84, 2016
2M91	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid Descriptor: 30-MER DNA Authors: Lim, K.W, Phan, A.T. Deposit date: 2013-05-30 Release date: 2013-07-10 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural basis of DNA quadruplex-duplex junction formation. Angew.Chem.Int.Ed.Engl., 52, 2013
2LV3	Structure-functional characterization of Grx domain of Mus musculus TGR Descriptor: Thioredoxin reductase 3 Authors: Dobrovolska, O, Shumilina, E, Gladyshev, V, Dikiy, A. Deposit date: 2012-06-28 Release date: 2013-05-22 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural analysis of glutaredoxin domain of Mus musculus thioredoxin glutathione reductase Plos One, 7, 2012
2MJR	Anoplin R5W structure in DPC micelles Descriptor: Anoplin, UNKNOWN ATOM OR ION, dodecyl 2-(trimethylammonio)ethyl phosphate Authors: Uggerhoej, L, Poulsen, T.J, Wimmer, R. Deposit date: 2014-01-16 Release date: 2014-12-03 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Rational Design of Alpha-Helical Antimicrobial Peptides: Do's and Don'ts. Chembiochem, 16, 2015

<511512513514515516517518519520521522523524525526>