2CKM
 
 | | Torpedo californica acetylcholinesterase complexed with alkylene- linked bis-tacrine dimer (7 carbon linker) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINESTERASE, N,N'-DI-1,2,3,4-TETRAHYDROACRIDIN-9-YLHEPTANE-1,7-DIAMINE | | Authors: | Brumshtein, B, Rydberg, E.H, Greenblatt, H.M, Wong, D.M, Shaya, D, Williams, L.D, Carlier, P.R, Pang, Y.P, Silman, I, Sussman, J.L. | | Deposit date: | 2006-04-20 | | Release date: | 2006-09-04 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Complexes of alkylene-linked tacrine dimers with Torpedo californica acetylcholinesterase: Binding of Bis5-tacrine produces a dramatic rearrangement in the active-site gorge.
J. Med. Chem., 49, 2006
|
|
2CEK
 | | Conformational Flexibility in the Peripheral Site of Torpedo californica Acetylcholinesterase Revealed by the Complex Structure with a Bifunctional Inhibitor | | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Sanson, B, Colletier, J.P, Nachon, F, Gabellieri, E, Fattorusso, C, Campiani, G, Weik, M. | | Deposit date: | 2006-02-08 | | Release date: | 2006-04-10 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Conformational flexibility in the peripheral site of Torpedo californica acetylcholinesterase revealed by the complex structure with a bifunctional inhibitor.
J. Am. Chem. Soc., 128, 2006
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
2J3Q
 | | Torpedo acetylcholinesterase complexed with fluorophore thioflavin T | | Descriptor: | 2-[4-(DIMETHYLAMINO)PHENYL]-6-HYDROXY-3-METHYL-1,3-BENZOTHIAZOL-3-IUM, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINESTERASE, ... | | Authors: | Harel, M, Cusack, B, Johnson, J.L, Silman, I, Sussman, J.L, Rosenberry, T.L. | | Deposit date: | 2006-08-23 | | Release date: | 2007-09-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of thioflavin T bound to the peripheral site of Torpedo californica acetylcholinesterase reveals how thioflavin T acts as a sensitive fluorescent reporter of ligand binding to the acylation site.
J. Am. Chem. Soc., 130, 2008
|
|
1TYO
 | | Isocitrate Dehydrogenase from the hyperthermophile Aeropyrum pernix in complex with etheno-NADP | | Descriptor: | ETHENO-NADP, isocitrate dehydrogenase | | Authors: | Karlstrom, M, Stokke, R, Steen, I.H, Birkeland, N, Ladenstein, R. | | Deposit date: | 2004-07-08 | | Release date: | 2005-07-08 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Isocitrate dehydrogenase from the hyperthermophile Aeropyrum pernix: X-ray structure analysis of a ternary enzyme-substrate complex and thermal stability
J.Mol.Biol., 345, 2005
|
|
1R5T
 | | The Crystal Structure of Cytidine Deaminase CDD1, an Orphan C to U editase from Yeast | | Descriptor: | Cytidine deaminase, ZINC ION | | Authors: | Xie, K, Sowden, M.P, Dance, G.S.C, Torelli, A.T, Smith, H.C, Wedekind, J.E. | | Deposit date: | 2003-10-13 | | Release date: | 2004-05-25 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The structure of a yeast RNA-editing deaminase provides insight into the fold and function of activation-induced deaminase and APOBEC-1.
Proc.Natl.Acad.Sci.Usa, 101, 2004
|
|
5LPN
 | | Structure of human Rab10 in complex with the bMERB domain of Mical-1 | | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, Protein-methionine sulfoxide oxidase MICAL1, ... | | Authors: | Rai, A, Oprisko, A, Campos, J, Fu, Y, Friese, T, Itzen, A, Goody, R.S, Mueller, M.P, Gazdag, E.M. | | Deposit date: | 2016-08-14 | | Release date: | 2016-08-24 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | bMERB domains are bivalent Rab8 family effectors evolved by gene duplication.
Elife, 5, 2016
|
|
5LQ0
 | | Crystal structure of Tyr24 phosphorylated Annexin A2 at 2.9 A resolution | | Descriptor: | Annexin A2, CALCIUM ION | | Authors: | Ecsedi, P, Gogl, G, Kiss, B, Nyitray, L. | | Deposit date: | 2016-08-15 | | Release date: | 2017-07-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Regulation of the Equilibrium between Closed and Open Conformations of Annexin A2 by N-Terminal Phosphorylation and S100A4-Binding.
Structure, 25, 2017
|
|
2J4F
 | | Torpedo acetylcholinesterase - Hg heavy-atom derivative | | Descriptor: | ACETYLCHOLINESTERASE, MERCURY (II) ION | | Authors: | Kreimer, D.I, Dolginova, E.A, Raves, M, Sussman, J.L, Silman, I, Weiner, L. | | Deposit date: | 2006-08-30 | | Release date: | 2006-09-05 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | A Metastable State of Torpedo Californica Acetylcholinesterase Generated by Modification with Organomercurials
Biochemistry, 33, 1994
|
|
3ROV
 | | Insulin's biosynthesis and activity have opposing structural requirements: a new factor in neonatal diabetes mellitus | | Descriptor: | CHLORIDE ION, Insulin, PHENOL, ... | | Authors: | Weiss, M.A, Wan, Z.L, Dodson, E.J, Liu, M, Xu, B, Hua, Q.X, Turkenburg, M, Whittingham, J, Nakagawa, S.H, Huang, K, Hu, S.Q, Jia, W.H, Wang, S.H, Brange, J, Whittaker, J, Arvan, P, Katsoyannis, P.G, Dodson, G.G. | | Deposit date: | 2011-04-26 | | Release date: | 2012-05-02 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Insulin's biosynthesis and activity have opposing structural requirements: a new factor in neonatal diabetes mellitus
To be Published
|
|
3QEF
 | | The structure and function of an arabinan-specific alpha-1,2-arabinofuranosidase identified from screening the activities of bacterial GH43 glycoside hydrolases | | Descriptor: | 1,2-ETHANEDIOL, Beta-xylosidase/alpha-L-arabinfuranosidase, gly43N, ... | | Authors: | Cartmell, A, Mckee, L.S, Pena, M, Larsbrink, J, Brumer, H, Lewis, R.J, Viks-Nielsen, A, Gilbert, H.J, Marles-Wright, J. | | Deposit date: | 2011-01-20 | | Release date: | 2011-02-16 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.789 Å) | | Cite: | The Structure and Function of an Arabinan-specific {alpha}-1,2-Arabinofuranosidase Identified from Screening the Activities of Bacterial GH43 Glycoside Hydrolases.
J.Biol.Chem., 286, 2011
|
|
1UTD
 | | The structure of the trp RNA-binding attenuation protein (TRAP) bound to a 63-nucleotide RNA molecule containing GAGUUU repeats | | Descriptor: | 5'-R(*GP*UP*UP*UP*GP*AP)-3', TRANSCRIPTION ATTENUATION PROTEIN MTRB, TRYPTOPHAN | | Authors: | Hopcroft, N.H, Manfredo, A, Wendt, A.L, Brzozowski, A.M, Gollnick, P, Antson, A.A. | | Deposit date: | 2003-12-08 | | Release date: | 2004-01-15 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The Interaction of RNA with Trap: The Role of Triplet Repeats and Separating Spacer Nucleotides
J.Mol.Biol., 338, 2004
|
|
1V7F
 | | Solution structure of phrixotoxin 1 | | Descriptor: | Phrixotoxin 1 | | Authors: | Chagot, B, Escoubas, P, Villegas, E, Bernard, C, Ferrat, G, Corzo, G, Lazdunski, M, Darbon, H. | | Deposit date: | 2003-12-16 | | Release date: | 2004-11-23 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of Phrixotoxin 1, a specific peptide inhibitor of Kv4 potassium channels from the venom of the theraphosid spider Phrixotrichus auratus
Protein Sci., 13, 2004
|
|
1V5B
 | | The Structure Of The Mutant, S225A and E251L, Of 3-Isopropylmalate Dehydrogenase From Bacillus Coagulans | | Descriptor: | 3-isopropylmalate dehydrogenase, SULFATE ION | | Authors: | Fujita, K, Minami, H, Suzuki, K, Tsunoda, M, Sekiguchi, T, Mizui, R, Tsuzaki, S, Nakamura, S, Takenaka, A. | | Deposit date: | 2003-11-22 | | Release date: | 2005-02-15 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.95 Å) | | Cite: | Crystal structure of a highly thermo-stabilized mutant of 3-isopropylmalate dehydrogenase from Bacillus coagulans: An evaluation of local packing density in the hydrophobic core
To be Published
|
|
1UUQ
 | | Exo-mannosidase from Cellvibrio mixtus | | Descriptor: | GLYCEROL, MANNOSYL-OLIGOSACCHARIDE GLUCOSIDASE, SULFATE ION | | Authors: | Dias, M.V.F, Vincent, F, Pell, G, Prates, J.A.M, Centeno, M.S.J, Ferreira, L.M.A, Gilbert, H.J, Davies, G.J, Fontes, C.M.G.A. | | Deposit date: | 2004-01-09 | | Release date: | 2004-04-16 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Insights Into the Molecular Determinants of Substrate Specificity in Glycoside Hydrolase Family 5 Revealed by the Crystal Structure and Kinetics of Cellvibrio Mixtus Mannosidase 5A
J.Biol.Chem., 279, 2004
|
|
1V53
 | | The crystal structure of 3-isopropylmalate dehydrogenase from Bacillus coagulans | | Descriptor: | 3-isopropylmalate dehydrogenase | | Authors: | Fujita, K, Minami, H, Suzuki, K, Tsunoda, M, Sekiguchi, T, Mizui, R, Tsuzaki, S, Nakamura, S, Takenaka, A. | | Deposit date: | 2003-11-20 | | Release date: | 2005-02-15 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | The crystal structure of 3-isopropylmalate dehydrogenase from Bacillus coagulans
To be Published
|
|
8ORA
 | | Human holo aromatic L-amino acid decarboxylase (AADC) external aldimine with L-Dopa methylester | | Descriptor: | Dopa decarboxylase (Aromatic L-amino acid decarboxylase), PYRIDOXAL-5'-PHOSPHATE, TETRAETHYLENE GLYCOL, ... | | Authors: | Bisello, G, Perduca, M, Bertoldi, M. | | Deposit date: | 2023-04-13 | | Release date: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Human aromatic amino acid decarboxylase is an asymmetric and flexible enzyme: Implication in aromatic amino acid decarboxylase deficiency.
Protein Sci., 32, 2023
|
|
8P2J
 | |
7EU9
 | | Crystal structure of the selenomethionine(SeMet)-derived Cas12i1 R-loop complex before target DNA cleavage | | Descriptor: | CITRIC ACID, Cas12i1 D647A mutant, DNA (24-MER), ... | | Authors: | Zhang, B, Luo, D.Y, Li, Y, OuYang, S.Y. | | Deposit date: | 2021-05-16 | | Release date: | 2021-05-26 | | Last modified: | 2021-06-23 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Mechanistic insights into the R-loop formation and cleavage in CRISPR-Cas12i1.
Nat Commun, 12, 2021
|
|
7RZU
 | |
7RZS
 | |
7RZR
 | |
5OWT
 | | Crystal structure of TNKS2 in complex with (5S)-5-methyl-5-[4-(4-oxo-3,4-dihydroquinazolin-2-yl)phenyl]imidazolidine-2,4-dione | | Descriptor: | (5S)-5-methyl-5-[4-(4-oxidanylidene-3H-quinazolin-2-yl)phenyl]imidazolidine-2,4-dione, SULFATE ION, Tankyrase-2, ... | | Authors: | Nkizinkiko, Y, Haikarainen, T, Lehtio, L. | | Deposit date: | 2017-09-04 | | Release date: | 2018-05-02 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | 2-Phenylquinazolinones as dual-activity tankyrase-kinase inhibitors.
Sci Rep, 8, 2018
|
|
7RZT
 | |
7RZV
 | |
