6FXQ
 
 | | Structure of coproheme decarboxylase from Listeria monocytogenes during turnover | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,3,5,8-TETRAMETHYL-PORPHINE-2,4,6,7-TETRAPROPIONIC ACID FERROUS COMPLEX, Putative heme-dependent peroxidase lmo2113, ... | | Authors: | Hofbauer, S, Pfanzagl, V, Mlynek, G, Puehringer, D. | | Deposit date: | 2018-03-09 | | Release date: | 2019-07-10 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Redox Cofactor Rotates during Its Stepwise Decarboxylation: Molecular Mechanism of Conversion of Coproheme to Hemeb.
Acs Catalysis, 9, 2019
|
|
8H8T
 | |
6G09
 | | Crystal Structure of a GH8 xylobiose complex from Teredinibacter turnerae | | Descriptor: | 1,2-ETHANEDIOL, Glycoside hydrolase family 8 domain protein, beta-D-xylopyranose-(1-4)-beta-D-xylopyranose | | Authors: | Fowler, C.A, Davies, G.J, Walton, P.H. | | Deposit date: | 2018-03-16 | | Release date: | 2018-10-10 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structure and function of a glycoside hydrolase family 8 endoxylanase from Teredinibacter turnerae.
Acta Crystallogr D Struct Biol, 74, 2018
|
|
2C5F
 | | Torpedo californica acetylcholinesterase in complex with a non hydrolysable substrate analogue, 4-oxo-N,N,N-trimethylpentanaminium | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 4,4-DIHYDROXY-N,N,N-TRIMETHYLPENTAN-1-AMINIUM, ACETYLCHOLINESTERASE, ... | | Authors: | Colletier, J.P, Fournier, D, Greenblatt, H.M, Sussman, J.L, Zaccai, G, Silman, I, Weik, M. | | Deposit date: | 2005-10-27 | | Release date: | 2006-06-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Insights Into Substrate Traffic and Inhibition in Acetylcholinesterase.
Embo J., 25, 2006
|
|
7LQ2
 | | Apo Rr RsiG- crystal form 1 | | Descriptor: | ISOPROPYL ALCOHOL, MAGNESIUM ION, RR RsiG | | Authors: | Schumacher, M.A, Brennan, R.G. | | Deposit date: | 2021-02-12 | | Release date: | 2021-07-14 | | Last modified: | 2021-08-25 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Evolution of a sigma-(c-di-GMP)-anti-sigma switch.
Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7LQ4
 | | Rr (RsiG)2-(c-di-GMP)2-WhiG complex | | Descriptor: | 9,9'-[(2R,3R,3aS,5S,7aR,9R,10R,10aS,12S,14aR)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecine-2,9-diyl]bis(2-amino-1,9-dihydro-6H-purin-6-one), RsiG, WhiG | | Authors: | Schumacher, M.A, Brennan, R.G. | | Deposit date: | 2021-02-12 | | Release date: | 2021-07-14 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Evolution of a sigma-(c-di-GMP)-anti-sigma switch.
Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7LQ3
 | |
3PMD
 | | Crystal structure of the sporulation inhibitor pXO1-118 from Bacillus anthracis | | Descriptor: | CHLORIDE ION, Conserved domain protein, UNDECANOIC ACID | | Authors: | Stranzl, G.R, Santelli, E, Bankston, L.A, La Clair, C, Bobkov, A, Schwarzenbacher, R, Godzik, A, Perego, M, Grynberg, M, Liddington, R.C. | | Deposit date: | 2010-11-16 | | Release date: | 2011-01-19 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | Structural Insights into Inhibition of Bacillus anthracis Sporulation by a Novel Class of Non-heme Globin Sensor Domains.
J.Biol.Chem., 286, 2011
|
|
5KK5
 | | AsCpf1(E993A)-crRNA-DNA ternary complex | | Descriptor: | CRISPR-associated endonuclease Cpf1, DNA (28-MER), DNA (8-mer), ... | | Authors: | Gao, P, Yang, H, Rajashankar, K.R, Huang, Z, Patel, D.J. | | Deposit date: | 2016-06-21 | | Release date: | 2016-08-10 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.289 Å) | | Cite: | Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition.
Cell Res., 26, 2016
|
|
3QEE
 | | The structure and function of an arabinan-specific alpha-1,2-arabinofuranosidase identified from screening the activities of bacterial GH43 glycoside hydrolases | | Descriptor: | ACETATE ION, Beta-xylosidase/alpha-L-arabinfuranosidase, gly43N, ... | | Authors: | Cartmell, A, Mckee, L.S, Pena, M, Larsbrink, J, Brumer, H, Lewis, R.J, Viks-Nielsen, A, Gilbert, H.J, Marles-Wright, J. | | Deposit date: | 2011-01-20 | | Release date: | 2011-02-16 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.64 Å) | | Cite: | The Structure and Function of an Arabinan-specific {alpha}-1,2-Arabinofuranosidase Identified from Screening the Activities of Bacterial GH43 Glycoside Hydrolases.
J.Biol.Chem., 286, 2011
|
|
2C5G
 | | Torpedo californica acetylcholinesterase in complex with 20mM thiocholine | | Descriptor: | 2-(TRIMETHYLAMMONIUM)ETHYL THIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINESTERASE, ... | | Authors: | Colletier, J.P, Fournier, D, Greenblatt, H.M, Sussman, J.L, Zaccai, G, Silman, I, Weik, M. | | Deposit date: | 2005-10-27 | | Release date: | 2006-06-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Structural Insights Into Substrate Traffic and Inhibition in Acetylcholinesterase.
Embo J., 25, 2006
|
|
3QED
 | | The structure and function of an arabinan-specific alpha-1,2-arabinofuranosidase identified from screening the activities of bacterial GH43 glycoside hydrolases | | Descriptor: | Beta-xylosidase/alpha-L-arabinfuranosidase, gly43N, CALCIUM ION, ... | | Authors: | Cartmell, A, Mckee, L.S, Pena, M, Larsbrink, J, Brumer, H, Lewis, R.J, Viks-Nielsen, A, Gilbert, H.J, Marles-Wright, J. | | Deposit date: | 2011-01-20 | | Release date: | 2011-02-16 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.99 Å) | | Cite: | The Structure and Function of an Arabinan-specific {alpha}-1,2-Arabinofuranosidase Identified from Screening the Activities of Bacterial GH43 Glycoside Hydrolases.
J.Biol.Chem., 286, 2011
|
|
6NMI
 | | Cryo-EM structure of the human TFIIH core complex | | Descriptor: | CDK-activating kinase assembly factor MAT1, General transcription and DNA repair factor IIH helicase subunit XPB, General transcription and DNA repair factor IIH helicase subunit XPD, ... | | Authors: | Greber, B.J, Toso, D, Fang, J, Nogales, E. | | Deposit date: | 2019-01-10 | | Release date: | 2019-03-13 | | Last modified: | 2019-12-18 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | The complete structure of the human TFIIH core complex.
Elife, 8, 2019
|
|
2HZ7
 | | Crystal structure of the Glutaminyl-tRNA synthetase from Deinococcus radiodurans | | Descriptor: | Glutaminyl-tRNA synthetase | | Authors: | Deniziak, M, Sauter, C, Becker, H.D, Paulus, C, Giege, R, Kern, D. | | Deposit date: | 2006-08-08 | | Release date: | 2007-04-24 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Deinococcus glutaminyl-tRNA synthetase is a chimer between proteins from an ancient and the modern pathways of aminoacyl-tRNA formation
Nucleic Acids Res., 35, 2007
|
|
1R1B
 | | EPRS SECOND REPEATED ELEMENT, NMR, MINIMIZED AVERAGE STRUCTURE | | Descriptor: | TRNA SYNTHETASE | | Authors: | Cahuzac, B, Berthonneau, E, Birlirakis, N, Mirande, M, Guittet, E. | | Deposit date: | 1998-12-15 | | Release date: | 1999-12-15 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | A recurrent RNA-binding domain is appended to eukaryotic aminoacyl-tRNA synthetases.
EMBO J., 19, 2000
|
|
3P2X
 | | Insulin fibrillation is the Janus face of induced fit. A chiaral clamp stabilizes the native state at the expense of activity | | Descriptor: | CHLORIDE ION, Insulin, PHENOL, ... | | Authors: | Hua, Q.X, Wan, Z.L, Huang, K, Hu, S.Q, Phillip, N.F, Jia, W.H, Whittingham, J, Dodson, G.G, Katsoyannis, P.G, Weiss, M.A. | | Deposit date: | 2010-10-04 | | Release date: | 2011-11-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Insulin fibrillation is the Janus face of induced fit. A chiral clamp stabilizes the native state at the expense of activity
To be Published
|
|
3P33
 | | Insulin fibrillation is the Janus face of induced fit. A chiral clamp stabilizes the native state at the expense of activity | | Descriptor: | CHLORIDE ION, Insulin, PHENOL, ... | | Authors: | Hua, Q.X, Wan, Z.L, Huang, K, Hu, S.Q, Phillip, N.F, Jia, W.H, Whittingham, J, Dodson, G.G, Katsoyannis, P.G, Weiss, M.A. | | Deposit date: | 2010-10-04 | | Release date: | 2011-11-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Insulin fibrillation is the Janus face of induced fit. A chiral clamp stabilizes the native state at the expense of activity
To be Published
|
|
6OPF
 | |
2CMF
 | | Torpedo californica acetylcholinesterase complexed with alkylene- linked bis-tacrine dimer (5 carbon linker) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINESTERASE, N,N'-DI-1,2,3,4-TETRAHYDROACRIDIN-9-YLPENTANE-1,5-DIAMINE | | Authors: | Rydberg, E.H, Brumshtein, B, Greenblatt, H.M, Wong, D.M, Pang, Y.P, Silman, I, Sussman, J.L. | | Deposit date: | 2006-05-08 | | Release date: | 2006-09-04 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Complexes of alkylene-linked tacrine dimers with Torpedo californica acetylcholinesterase: Binding of Bis5-tacrine produces a dramatic rearrangement in the active-site gorge.
J. Med. Chem., 49, 2006
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
5LPX
 | | Crystal structure of PKC phosphorylation-mimicking mutant (S26E) Annexin A2 | | Descriptor: | Annexin A2, CALCIUM ION, GLYCEROL | | Authors: | Ecsedi, P, Gogl, G, Kiss, B, Nyitray, L. | | Deposit date: | 2016-08-15 | | Release date: | 2017-07-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Regulation of the Equilibrium between Closed and Open Conformations of Annexin A2 by N-Terminal Phosphorylation and S100A4-Binding.
Structure, 25, 2017
|
|
3QJ4
 | | Crystal structure of Human Renalase (isoform 1) | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, Renalase, SULFATE ION | | Authors: | Milani, M, Ciriello, F, Baroni, S, Pandini, V, Aliverti, A, Canevari, G, Bolognesi, M. | | Deposit date: | 2011-01-28 | | Release date: | 2011-07-13 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | FAD-binding site and NADP reactivity in human renalase: a new enzyme involved in blood pressure regulation
J.Mol.Biol., 411, 2011
|
|
6O5Y
 | | Structure of Human Cytochrome P450 1A1 with 5-amino-N-(5-((4R,5R)-4-amino-5-fluoroazepan-1-yl)-1-methyl-1H-pyrazol-4-yl)-2-(2,6-difluorophenyl)thiazole-4-carboxamide) | | Descriptor: | 5-amino-N-{5-[(4R,5R)-4-amino-5-fluoroazepan-1-yl]-1-methyl-1H-pyrazol-4-yl}-2-(2,6-difluorophenyl)-1,3-thiazole-4-carboxamide, Cytochrome P450 1A1, NITRATE ION, ... | | Authors: | Bart, A.G, Scott, E.E. | | Deposit date: | 2019-03-04 | | Release date: | 2019-12-04 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.17 Å) | | Cite: | Human Cytochrome P450 1A1 Adapts Active Site for Atypical Nonplanar Substrate.
Drug Metab.Dispos., 48, 2020
|
|
2J3D
 | |
5LQ2
 | | Crystal structure of Tyr24 phosphorylated Annexin A2 at 3.4 A resolution | | Descriptor: | Annexin A2, CALCIUM ION | | Authors: | Ecsedi, P, Gogl, G, Kiss, B, Nyitray, L. | | Deposit date: | 2016-08-15 | | Release date: | 2017-07-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.4 Å) | | Cite: | Regulation of the Equilibrium between Closed and Open Conformations of Annexin A2 by N-Terminal Phosphorylation and S100A4-Binding.
Structure, 25, 2017
|
|
