4L3B
| X-ray structure of the HRV2 A particle uncoating intermediate | Descriptor: | Protein VP1, Protein VP2, Protein VP3 | Authors: | Vives-Adrian, L, Querol-Audi, J, Garriga, D, Pous, J, Verdaguer, N. | Deposit date: | 2013-06-05 | Release date: | 2013-11-27 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (6.5 Å) | Cite: | Uncoating of common cold virus is preceded by RNA switching as determined by X-ray and cryo-EM analyses of the subviral A-particle. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
8PTG
| Structure of the transcription termination factor Rho bound to RNA at the PBS and SBS | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, MAGNESIUM ION, ... | Authors: | Said, N, Hilal, T, Wahl, M.C. | Deposit date: | 2023-07-14 | Release date: | 2024-04-17 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Sm-like protein Rof inhibits transcription termination factor rho by binding site obstruction and conformational insulation. Nat Commun, 15, 2024
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
2MTF
| Solution structure of the La motif of human LARP6 | Descriptor: | La-related protein 6 | Authors: | Martino, L, Salisbury, N.JH, Atkinson, A.R, Kelly, G, Conte, M.R. | Deposit date: | 2014-08-18 | Release date: | 2014-12-24 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Synergic interplay of the La motif, RRM1 and the interdomain linker of LARP6 in the recognition of collagen mRNA expands the RNA binding repertoire of the La module. Nucleic Acids Res., 43, 2015
|
|
8UMT
| Atomic model of the human CTF18-RFC-PCNA binary complex in the three-subunit binding state (state 2) | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Chromosome transmission fidelity protein 18 homolog, MAGNESIUM ION, ... | Authors: | Wang, F, He, Q, Li, H. | Deposit date: | 2023-10-18 | Release date: | 2024-05-08 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.33 Å) | Cite: | Cryo-EM reveals a nearly complete PCNA loading process and unique features of the human alternative clamp loader CTF18-RFC. Proc.Natl.Acad.Sci.USA, 121, 2024
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
4QM7
| Structure of bacterial polynucleotide kinase bound to GTP and pDNA | Descriptor: | DNA, GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Das, U, Wang, L.K, Smith, P, Shuman, S. | Deposit date: | 2014-06-15 | Release date: | 2014-10-08 | Last modified: | 2015-02-18 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structures of bacterial polynucleotide kinase in a michaelis complex with nucleoside triphosphate (NTP)-Mg2+ and 5'-OH RNA and a mixed substrate-product complex with NTP-Mg2+ and a 5'-phosphorylated oligonucleotide. J.Bacteriol., 196, 2014
|
|
3KC6
| |
4H4K
| Structure of the Cmr2-Cmr3 subcomplex of the Cmr RNA-silencing complex | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CRISPR system Cmr subunit Cmr2, CRISPR system Cmr subunit Cmr3, ... | Authors: | Shao, Y, Cocozaki, A.I, Ramia, N.F, Terns, R.M, Terns, M.P, Li, H. | Deposit date: | 2012-09-17 | Release date: | 2013-03-06 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.804 Å) | Cite: | Structure of the cmr2-cmr3 subcomplex of the cmr RNA silencing complex. Structure, 21, 2013
|
|
2MTG
| Solution structure of the RRM1 of human LARP6 | Descriptor: | La-related protein 6 | Authors: | Martino, L, Atkinson, A.R, Kelly, G, Conte, M.R. | Deposit date: | 2014-08-18 | Release date: | 2014-12-24 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Synergic interplay of the La motif, RRM1 and the interdomain linker of LARP6 in the recognition of collagen mRNA expands the RNA binding repertoire of the La module. Nucleic Acids Res., 43, 2015
|
|
7KL3
| The crystal structure of the 2009/H1N1/California PA endonuclease mutant E119D bound to RNA oligomer AG*CAUC (*uncleaveable bond, -UC disordered) | Descriptor: | 5'-O-sulfocytidine, ADENOSINE MONOPHOSPHATE, GLYCEROL, ... | Authors: | Cuypers, M.G, Kumar, G, White, S.W. | Deposit date: | 2020-10-28 | Release date: | 2021-02-03 | Last modified: | 2024-05-29 | Method: | X-RAY DIFFRACTION (1.99 Å) | Cite: | Structural insights into the substrate specificity of the endonuclease activity of the influenza virus cap-snatching mechanism. Nucleic Acids Res., 49, 2021
|
|
5UV5
| Crystal Structure of a 2-Hydroxyisoquinoline-1,3-dione RNase H Active Site Inhibitor with Multiple Binding Modes to HIV Reverse Transcriptase | Descriptor: | 7-(furan-2-yl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione, MANGANESE (II) ION, Reverse transcriptase/ribonuclease H, ... | Authors: | Kirby, K.A, Sarafianos, S.G. | Deposit date: | 2017-02-19 | Release date: | 2017-08-16 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | A 2-Hydroxyisoquinoline-1,3-Dione Active-Site RNase H Inhibitor Binds in Multiple Modes to HIV-1 Reverse Transcriptase. Antimicrob. Agents Chemother., 61, 2017
|
|
4KFZ
| Crystal structure of LMO2 and anti-LMO2 VH complex | Descriptor: | Anti-LMO2 VH, LMO-2, ZINC ION | Authors: | Sewell, H, Tanaka, T, El Omari, K, Cruz-Migoni, A, Mancini, E.J, Fuentes-Fernandez, N, Chambers, J, Rabbitts, T.H. | Deposit date: | 2013-04-28 | Release date: | 2014-01-22 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Conformational flexibility of the oncogenic protein LMO2 primes the formation of the multi-protein transcription complex. Sci Rep, 4, 2014
|
|
3GDX
| Dna polymerase beta with a gapped DND substrate and dTMP(CF2)PP | Descriptor: | 5'-D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3', ... | Authors: | Wilson, S.H, Batra, V.K, Pedersen, L.C. | Deposit date: | 2009-02-24 | Release date: | 2009-05-05 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Alpha,beta-difluoromethylene deoxynucleoside 5'-triphosphates: a convenient synthesis of useful probes for DNA polymerase beta structure and function Org.Lett., 11, 2009
|
|
1DML
| CRYSTAL STRUCTURE OF HERPES SIMPLEX UL42 BOUND TO THE C-TERMINUS OF HSV POL | Descriptor: | DNA POLYMERASE, DNA POLYMERASE PROCESSIVITY FACTOR | Authors: | Zuccola, H.J, Filman, D.J, Coen, D.M, Hogle, J.M. | Deposit date: | 1999-12-14 | Release date: | 2000-03-15 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | The crystal structure of an unusual processivity factor, herpes simplex virus UL42, bound to the C terminus of its cognate polymerase. Mol.Cell, 5, 2000
|
|
1G6Q
| CRYSTAL STRUCTURE OF YEAST ARGININE METHYLTRANSFERASE, HMT1 | Descriptor: | HNRNP ARGININE N-METHYLTRANSFERASE | Authors: | Weiss, V.H, McBride, A.E, Soriano, M.A, Filman, D.J, Silver, P.A, Hogle, J.M. | Deposit date: | 2000-11-07 | Release date: | 2000-12-06 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | The structure and oligomerization of the yeast arginine methyltransferase, Hmt1. Nat.Struct.Biol., 7, 2000
|
|
3KHW
| |
7OA4
| Crystal structure of the N-terminal endonuclease domain of La Crosse virus L-protein bound to compound L-742,001 | Descriptor: | (2Z)-4-[1-benzyl-4-(4-chlorobenzyl)piperidin-4-yl]-2-hydroxy-4-oxobut-2-enoic acid, FORMIC ACID, MANGANESE (II) ION, ... | Authors: | Feracci, M, Hernandez, S, Vincentelli, R, Ferron, F, Reguera, J, Canard, B, Alvarez, K. | Deposit date: | 2021-04-19 | Release date: | 2022-08-03 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of the N-terminal endonuclease domain of La Crosse virus L-protein bound to compound L-742,001 To Be Published
|
|
3PTO
| |
4LMO
| |
3MCT
| VACCINIA METHYLTRANSFERASE VP39 COMPLEXED WITH M3CYT AND S-ADENOSYLHOMOCYSTEINE | Descriptor: | 3-METHYLCYTOSINE, S-ADENOSYL-L-HOMOCYSTEINE, VP39 | Authors: | Hu, G, Gershon, P.D, Hodel, A.E, Quiocho, F.A. | Deposit date: | 1999-01-05 | Release date: | 1999-07-22 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | mRNA cap recognition: dominant role of enhanced stacking interactions between methylated bases and protein aromatic side chains. Proc.Natl.Acad.Sci.USA, 96, 1999
|
|
3PR5
| Dpo4 Y12A mutant incorporating ADP opposite template dT | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*TP*C)-3'), ... | Authors: | Kirouac, K.N, Ling, H. | Deposit date: | 2010-11-29 | Release date: | 2011-02-23 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural mechanism of ribonucleotide discrimination by a Y-family DNA polymerase. J.Mol.Biol., 407, 2011
|
|
1AKH
| MAT A1/ALPHA2/DNA TERNARY COMPLEX | Descriptor: | DNA (5'-D(*TP*AP*CP*AP*TP*GP*TP*AP*AP*AP*AP*AP*TP*TP*TP*AP*C P*AP*TP*CP*A)-3'), DNA (5'-D(*TP*AP*TP*GP*AP*TP*GP*TP*AP*AP*AP*TP*TP*TP*TP*TP*A P*CP*AP*TP*G)-3'), PROTEIN (MATING-TYPE PROTEIN A-1), ... | Authors: | Li, T, Jin, Y, Vershon, A.K, Wolberger, C. | Deposit date: | 1997-05-19 | Release date: | 1998-05-20 | Last modified: | 2023-08-02 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structure of the MATa1/MATalpha2 homeodomain heterodimer in complex with DNA containing an A-tract. Nucleic Acids Res., 26, 1998
|
|
5T3W
| |
3M9M
| |