5E3M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3m by Molmil](/molmil-images/mine/5e3m) | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5EB1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5eb1 by Molmil](/molmil-images/mine/5eb1) | the YfiB-YfiR complex | Descriptor: | SULFATE ION, YfiB, YfiR | Authors: | Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. | Deposit date: | 2015-10-17 | Release date: | 2016-05-18 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
|
|
5EB3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5eb3 by Molmil](/molmil-images/mine/5eb3) | VB6-bound protein | Descriptor: | 4,5-bis(hydroxymethyl)-2-methyl-pyridin-3-ol, SULFATE ION, YfiR | Authors: | Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. | Deposit date: | 2015-10-17 | Release date: | 2016-05-18 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
|
|
4H1I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4h1i by Molmil](/molmil-images/mine/4h1i) | |
4IEJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4iej by Molmil](/molmil-images/mine/4iej) | |
3NI3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ni3 by Molmil](/molmil-images/mine/3ni3) | 54-Membered ring macrocyclic beta-sheet peptide | Descriptor: | 54-membered ring macrocyclic beta-sheet peptide, ISOPROPYL ALCOHOL | Authors: | Sawaya, M.R, Eisenberg, D, Nowick, J.S, Korman, T.P, Khakshoor, O. | Deposit date: | 2010-06-15 | Release date: | 2010-09-15 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.34 Å) | Cite: | X-ray crystallographic structure of an artificial beta-sheet dimer. J.Am.Chem.Soc., 132, 2010
|
|
3CFV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3cfv by Molmil](/molmil-images/mine/3cfv) | Structural basis of the interaction of RbAp46/RbAp48 with histone H4 | Descriptor: | ARSENIC, Histone H4 peptide, Histone-binding protein RBBP7 | Authors: | Pei, X.-Y, Murzina, N.V, Zhang, W, McLaughlin, S, Verreault, A, Luisi, B.F, Laue, E.D. | Deposit date: | 2008-03-04 | Release date: | 2008-06-10 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural Basis for the Recognition of Histone H4 by the Histone-Chaperone RbAp46. Structure, 16, 2008
|
|
4I80
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4i80 by Molmil](/molmil-images/mine/4i80) | |
6IQE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6iqe by Molmil](/molmil-images/mine/6iqe) | Human prohibitin 2 | Descriptor: | Prohibitin-2 | Authors: | Hirano, Y, Koshiba, T, Tamada, T. | Deposit date: | 2018-11-07 | Release date: | 2019-09-25 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.701 Å) | Cite: | Structural Basis of Mitochondrial Scaffolds by Prohibitin Complexes: Insight into a Role of the Coiled-Coil Region. Iscience, 19, 2019
|
|
1ZVV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1zvv by Molmil](/molmil-images/mine/1zvv) | Crystal structure of a ccpa-crh-dna complex | Descriptor: | DNA recognition strand CRE, Glucose-resistance amylase regulator, HPr-like protein crh, ... | Authors: | Schumacher, M.A, Brennan, R.G, Hillen, W, Seidel, G. | Deposit date: | 2005-06-02 | Release date: | 2006-02-07 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.98 Å) | Cite: | Phosphoprotein Crh-Ser46-P displays altered binding to CcpA to effect carbon catabolite regulation. J.Biol.Chem., 281, 2006
|
|
4RQI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4rqi by Molmil](/molmil-images/mine/4rqi) | Structure of TRF2/RAP1 secondary interaction binding site | Descriptor: | GLYCEROL, MAGNESIUM ION, Telomeric repeat-binding factor 2, ... | Authors: | Miron, S, Guimaraes, B, Gaullier, G, Giraud-Panis, M.-J, Gilson, E, Le Du, M.-H. | Deposit date: | 2014-11-03 | Release date: | 2016-02-10 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.4405 Å) | Cite: | A higher-order entity formed by the flexible assembly of RAP1 with TRF2. Nucleic Acids Res., 44, 2016
|
|
7AX1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ax1 by Molmil](/molmil-images/mine/7ax1) | Crystal structure of the human CCR4-CAF1 complex | Descriptor: | CCR4-NOT transcription complex subunit 6, CCR4-NOT transcription complex subunit 7, MAGNESIUM ION | Authors: | Chen, Y, Khazina, E, Weichenrieder, O. | Deposit date: | 2020-11-09 | Release date: | 2021-05-12 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Crystal structure and functional properties of the human CCR4-CAF1 deadenylase complex. Nucleic Acids Res., 49, 2021
|
|
4BJ5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bj5 by Molmil](/molmil-images/mine/4bj5) | Crystal structure of Rif2 in complex with the C-terminal domain of Rap1 (Rap1-RCT) | Descriptor: | DNA-BINDING PROTEIN RAP1, PROTEIN RIF2, SULFATE ION | Authors: | Shi, T, Bunker, R.D, Gut, H, Scrima, A, Thoma, N.H. | Deposit date: | 2013-04-16 | Release date: | 2013-06-19 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (3.29 Å) | Cite: | Rif1 and Rif2 Shape Telomere Funcation and Architecture Through Multivalent RAP1 Interactions Cell(Cambridge,Mass.), 153, 2013
|
|
6IHJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ihj by Molmil](/molmil-images/mine/6ihj) | |
3KH2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3kh2 by Molmil](/molmil-images/mine/3kh2) | Crystal structure of the P1 bacteriophage Doc toxin (F68S) in complex with the Phd antitoxin (L17M/V39A). Northeast Structural Genomics targets ER385-ER386 | Descriptor: | 2-HYDROXYETHYL DISULFIDE, CHLORIDE ION, Death on curing protein, ... | Authors: | Arbing, M.A, Kuzin, A.P, Su, M, Abashidze, M, Verdon, G, Liu, M, Xiao, R, Acton, T, Inouye, M, Montelione, G.T, Woychik, N.A, Hunt, J.F, Northeast Structural Genomics Consortium (NESG) | Deposit date: | 2009-10-29 | Release date: | 2010-08-18 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.71 Å) | Cite: | Crystal Structures of Phd-Doc, HigA, and YeeU Establish Multiple Evolutionary Links between Microbial Growth-Regulating Toxin-Antitoxin Systems. Structure, 18, 2010
|
|
7K3J
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7k3j by Molmil](/molmil-images/mine/7k3j) | |
7K3K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7k3k by Molmil](/molmil-images/mine/7k3k) | |
7K3L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7k3l by Molmil](/molmil-images/mine/7k3l) | |
2AXV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2axv by Molmil](/molmil-images/mine/2axv) | Structure of PrgX Y153C mutant | Descriptor: | PrgX | Authors: | Shi, K, Brown, C.K, Gu, Z.Y, Kozlowicz, B.K, Dunny, G.M, Ohlendorf, D.H, Earhart, C.A. | Deposit date: | 2005-09-06 | Release date: | 2005-12-06 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis. Proc.Natl.Acad.Sci.Usa, 102, 2005
|
|
3LLR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3llr by Molmil](/molmil-images/mine/3llr) | Crystal structure of the PWWP domain of Human DNA (cytosine-5-)-methyltransferase 3 alpha | Descriptor: | 2-[BIS-(2-HYDROXY-ETHYL)-AMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DNA (cytosine-5)-methyltransferase 3A, SULFATE ION | Authors: | Qiu, W, Dombrovski, L, Ni, S, Weigelt, J, Boutra, C, Arrowsmith, C.H, Edwards, A.M, Min, J, Wu, H, Structural Genomics Consortium (SGC) | Deposit date: | 2010-01-29 | Release date: | 2010-03-23 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structural and histone binding ability characterizations of human PWWP domains. Plos One, 6, 2011
|
|
3LGH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lgh by Molmil](/molmil-images/mine/3lgh) | |
3M4T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3m4t by Molmil](/molmil-images/mine/3m4t) | |
3JRG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3jrg by Molmil](/molmil-images/mine/3jrg) | |
3JRC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3jrc by Molmil](/molmil-images/mine/3jrc) | |
3JRI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3jri by Molmil](/molmil-images/mine/3jri) | |