PDB: 2606 resultsInfo pagesStatus searchChemie searchBIRD

---

5E3M	Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) Descriptor: DNA (27-MER), DNA-binding protein Fis Authors: Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. Deposit date: 2015-10-03 Release date: 2016-03-09 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2.886 Å) Cite: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
5EB1	the YfiB-YfiR complex Descriptor: SULFATE ION, YfiB, YfiR Authors: Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. Deposit date: 2015-10-17 Release date: 2016-05-18 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
5EB3	VB6-bound protein Descriptor: 4,5-bis(hydroxymethyl)-2-methyl-pyridin-3-ol, SULFATE ION, YfiR Authors: Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. Deposit date: 2015-10-17 Release date: 2016-05-18 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
4H1I	Structure of human thymidylate synthase at low salt conditions Descriptor: SULFATE ION, Thymidylate synthase Authors: Brunn, N, Dibrov, S, Hermann, T. Deposit date: 2012-09-10 Release date: 2012-10-03 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (3.095 Å) Cite: Analysis of mRNA recognition by human thymidylate synthase. Biosci.Rep., 34, 2014
4IEJ	Crystal structure of a DNA methyltransferase 1 associated protein 1 (DMAP1) from Homo sapiens at 1.45 A resolution Descriptor: CALCIUM ION, DNA methyltransferase 1-associated protein 1 Authors: Joint Center for Structural Genomics (JCSG), Partnership for T-Cell Biology (TCELL) Deposit date: 2012-12-13 Release date: 2013-01-02 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (1.45 Å) Cite: Crystal structure of a DNA methyltransferase 1 associated protein 1 (DMAP1) from Homo sapiens at 1.45 A resolution To be published
3NI3	54-Membered ring macrocyclic beta-sheet peptide Descriptor: 54-membered ring macrocyclic beta-sheet peptide, ISOPROPYL ALCOHOL Authors: Sawaya, M.R, Eisenberg, D, Nowick, J.S, Korman, T.P, Khakshoor, O. Deposit date: 2010-06-15 Release date: 2010-09-15 Last modified: 2023-11-15 Method: X-RAY DIFFRACTION (1.34 Å) Cite: X-ray crystallographic structure of an artificial beta-sheet dimer. J.Am.Chem.Soc., 132, 2010
3CFV	Structural basis of the interaction of RbAp46/RbAp48 with histone H4 Descriptor: ARSENIC, Histone H4 peptide, Histone-binding protein RBBP7 Authors: Pei, X.-Y, Murzina, N.V, Zhang, W, McLaughlin, S, Verreault, A, Luisi, B.F, Laue, E.D. Deposit date: 2008-03-04 Release date: 2008-06-10 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Structural Basis for the Recognition of Histone H4 by the Histone-Chaperone RbAp46. Structure, 16, 2008
4I80	Crystal structure of human menin in complex with a high-affinity macrocyclic peptidomimetics Descriptor: Menin, macrocyclic peptidomimetic Authors: Huang, J, Lei, M. Deposit date: 2012-12-01 Release date: 2013-03-06 Last modified: 2017-11-15 Method: X-RAY DIFFRACTION (3.1 Å) Cite: Structure-Based Design of High-Affinity Macrocyclic Peptidomimetics to Block the Menin-Mixed Lineage Leukemia 1 (MLL1) Protein-Protein Interaction. J.Med.Chem., 56, 2013
6IQE	Human prohibitin 2 Descriptor: Prohibitin-2 Authors: Hirano, Y, Koshiba, T, Tamada, T. Deposit date: 2018-11-07 Release date: 2019-09-25 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (1.701 Å) Cite: Structural Basis of Mitochondrial Scaffolds by Prohibitin Complexes: Insight into a Role of the Coiled-Coil Region. Iscience, 19, 2019
1ZVV	Crystal structure of a ccpa-crh-dna complex Descriptor: DNA recognition strand CRE, Glucose-resistance amylase regulator, HPr-like protein crh, ... Authors: Schumacher, M.A, Brennan, R.G, Hillen, W, Seidel, G. Deposit date: 2005-06-02 Release date: 2006-02-07 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.98 Å) Cite: Phosphoprotein Crh-Ser46-P displays altered binding to CcpA to effect carbon catabolite regulation. J.Biol.Chem., 281, 2006
4RQI	Structure of TRF2/RAP1 secondary interaction binding site Descriptor: GLYCEROL, MAGNESIUM ION, Telomeric repeat-binding factor 2, ... Authors: Miron, S, Guimaraes, B, Gaullier, G, Giraud-Panis, M.-J, Gilson, E, Le Du, M.-H. Deposit date: 2014-11-03 Release date: 2016-02-10 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.4405 Å) Cite: A higher-order entity formed by the flexible assembly of RAP1 with TRF2. Nucleic Acids Res., 44, 2016
7AX1	Crystal structure of the human CCR4-CAF1 complex Descriptor: CCR4-NOT transcription complex subunit 6, CCR4-NOT transcription complex subunit 7, MAGNESIUM ION Authors: Chen, Y, Khazina, E, Weichenrieder, O. Deposit date: 2020-11-09 Release date: 2021-05-12 Last modified: 2024-01-31 Method: X-RAY DIFFRACTION (3.3 Å) Cite: Crystal structure and functional properties of the human CCR4-CAF1 deadenylase complex. Nucleic Acids Res., 49, 2021
4BJ5	Crystal structure of Rif2 in complex with the C-terminal domain of Rap1 (Rap1-RCT) Descriptor: DNA-BINDING PROTEIN RAP1, PROTEIN RIF2, SULFATE ION Authors: Shi, T, Bunker, R.D, Gut, H, Scrima, A, Thoma, N.H. Deposit date: 2013-04-16 Release date: 2013-06-19 Last modified: 2023-12-20 Method: X-RAY DIFFRACTION (3.29 Å) Cite: Rif1 and Rif2 Shape Telomere Funcation and Architecture Through Multivalent RAP1 Interactions Cell(Cambridge,Mass.), 153, 2013
6IHJ	Crystal structure of Drosophila Nxf1 NTF2 domain in complex with Nxt1/p15 Descriptor: NTF2-related export protein, Nuclear RNA export factor 1 Authors: Huang, Y, Yuan, X. Deposit date: 2018-09-30 Release date: 2019-08-14 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2.7 Å) Cite: A Pandas complex adapted for piRNA-guided transcriptional silencing and heterochromatin formation. Nat.Cell Biol., 21, 2019
3KH2	Crystal structure of the P1 bacteriophage Doc toxin (F68S) in complex with the Phd antitoxin (L17M/V39A). Northeast Structural Genomics targets ER385-ER386 Descriptor: 2-HYDROXYETHYL DISULFIDE, CHLORIDE ION, Death on curing protein, ... Authors: Arbing, M.A, Kuzin, A.P, Su, M, Abashidze, M, Verdon, G, Liu, M, Xiao, R, Acton, T, Inouye, M, Montelione, G.T, Woychik, N.A, Hunt, J.F, Northeast Structural Genomics Consortium (NESG) Deposit date: 2009-10-29 Release date: 2010-08-18 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2.71 Å) Cite: Crystal Structures of Phd-Doc, HigA, and YeeU Establish Multiple Evolutionary Links between Microbial Growth-Regulating Toxin-Antitoxin Systems. Structure, 18, 2010
7K3J	Crystal structure of dLC8 in complex with Panoramix TQT+TQ peptide Descriptor: Dynein light chain 1, cytoplasmic, Protein panoramix, ... Authors: Wang, J, Patel, D.J. Deposit date: 2020-09-11 Release date: 2021-03-03 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Molecular principles of Piwi-mediated cotranscriptional silencing through the dimeric SFiNX complex. Genes Dev., 35, 2021
7K3K	Crystal structure of dLC8 in complex with Panoramix TQT peptide Descriptor: Dynein light chain 1, cytoplasmic, Protein panoramix Authors: Wang, J, Patel, D.J. Deposit date: 2020-09-11 Release date: 2021-03-03 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (1.415 Å) Cite: Molecular principles of Piwi-mediated cotranscriptional silencing through the dimeric SFiNX complex. Genes Dev., 35, 2021
7K3L	Crystal structure of dLC8 in complex with Panoramix TQ peptide Descriptor: 1,2-ETHANEDIOL, Dynein light chain 1, cytoplasmic, ... Authors: Wang, J, Patel, D.J. Deposit date: 2020-09-11 Release date: 2021-03-03 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (1.79 Å) Cite: Molecular principles of Piwi-mediated cotranscriptional silencing through the dimeric SFiNX complex. Genes Dev., 35, 2021
2AXV	Structure of PrgX Y153C mutant Descriptor: PrgX Authors: Shi, K, Brown, C.K, Gu, Z.Y, Kozlowicz, B.K, Dunny, G.M, Ohlendorf, D.H, Earhart, C.A. Deposit date: 2005-09-06 Release date: 2005-12-06 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (3 Å) Cite: Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis. Proc.Natl.Acad.Sci.Usa, 102, 2005
3LLR	Crystal structure of the PWWP domain of Human DNA (cytosine-5-)-methyltransferase 3 alpha Descriptor: 2-[BIS-(2-HYDROXY-ETHYL)-AMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DNA (cytosine-5)-methyltransferase 3A, SULFATE ION Authors: Qiu, W, Dombrovski, L, Ni, S, Weigelt, J, Boutra, C, Arrowsmith, C.H, Edwards, A.M, Min, J, Wu, H, Structural Genomics Consortium (SGC) Deposit date: 2010-01-29 Release date: 2010-03-23 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Structural and histone binding ability characterizations of human PWWP domains. Plos One, 6, 2011
3LGH	Crystal structure of NikR from Helicobacter pylori with variable Ni site coordination Descriptor: MAGNESIUM ION, NICKEL (II) ION, nickel-responsive regulator Authors: Pozharski, E, St John, F. Deposit date: 2010-01-20 Release date: 2010-09-15 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (2.37 Å) Cite: Holo-Ni(II)HpNikR Is an Asymmetric Tetramer Containing Two Different Nickel-Binding Sites. J.Am.Chem.Soc., 132, 2010
3M4T	Crystal structure of the BTB domain from Kaiso/ZBTB33, form I Descriptor: SULFATE ION, Transcriptional regulator Kaiso Authors: Stogios, P.J, Chen, L, Prive, G.G. Deposit date: 2010-03-11 Release date: 2011-04-27 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (2.05 Å) Cite: Crystal structure of the BTB domain from Kaiso/ZBTB33, form I TO BE PUBLISHED
3JRG	Crystal structure of Fis bound to 27 bp non consensus sequence DNA F18 Descriptor: DNA (27-MER), DNA-binding protein fis Authors: Stella, S, Cascio, D, Johnson, R.C. Deposit date: 2009-09-08 Release date: 2010-04-28 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.11 Å) Cite: The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev., 24, 2010
3JRC	Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at center Descriptor: DNA (27-MER), DNA-binding protein fis Authors: Stella, S, Cascio, D, Johnson, R.C. Deposit date: 2009-09-08 Release date: 2010-04-28 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.08 Å) Cite: The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev., 24, 2010
3JRI	Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23 Descriptor: DNA (27-MER), DNA-binding protein fis Authors: Stella, S, Cascio, D, Johnson, R.C. Deposit date: 2009-09-08 Release date: 2010-04-28 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.11 Å) Cite: The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev., 24, 2010

<77787980818283848586878889909192>