PDB: 30672 resultsInfo pagesStatus searchChemie searchBIRD

---

2MEQ	Structure of Helix 69 from Escherichia coli 23S Ribosomal RNA Descriptor: RNA_(5'-R(P*GP*GP*CP*CP*GP*UP*AP*AP*CP*UP*AP*UP*AP*AP*CP*GP*GP*UP*C)-3') Authors: Jiang, J, Aduri, R, Chow, C.S, Santalucia, J. Deposit date: 2013-09-26 Release date: 2014-01-01 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure modulation of helix 69 from Escherichia coli 23S ribosomal RNA by pseudouridylations. Nucleic Acids Res., 42, 2014
1TLR	SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES Descriptor: RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') Authors: Butcher, S.E, Dieckmann, T, Feigon, J. Deposit date: 1997-09-11 Release date: 1997-11-12 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of a GAAA tetraloop receptor RNA. EMBO J., 16, 1997
1RHT	24-MER RNA HAIRPIN COAT PROTEIN BINDING SITE FOR BACTERIOPHAGE R17 (NMR, MINIMIZED AVERAGE STRUCTURE) Descriptor: RNA (5'-R(P*GP*GP*GP*AP*CP*UP*GP*AP*CP*GP*AP*UP*CP*AP*CP*GP*CP*AP*GP*UP*CP*UP*AP*U)-3') Authors: Borer, P.N, Lin, Y, Wang, S, Roggenbuck, M.W, Gott, J.M, Uhlenbeck, O.C, Pelczer, I. Deposit date: 1995-03-03 Release date: 1995-06-03 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Proton NMR and structural features of a 24-nucleotide RNA hairpin. Biochemistry, 34, 1995
1RNK	THE STRUCTURE OF AN RNA PSEUDOKNOT THAT CAUSES EFFICIENT FRAMESHIFTING IN MOUSE MAMMARY TUMOR VIRUS Descriptor: RNA PSEUDOKNOT Authors: Shen, L.X, Tinoco Junior, I. Deposit date: 1995-01-11 Release date: 1995-02-27 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: The structure of an RNA pseudoknot that causes efficient frameshifting in mouse mammary tumor virus. J.Mol.Biol., 247, 1995
1UUU	STRUCTURE OF AN RNA HAIRPIN LOOP WITH A 5'-CGUUUCG-3' LOOP MOTIF BY HETERONUCLEAR NMR SPECTROSCOPY AND DISTANCE GEOMETRY, 15 STRUCTURES Descriptor: RNA (5'-R(*GP*GP*CP*GP*UP*AP*CP*GP*UP*UP*UP*CP*GP*UP*AP*CP*GP*CP*C)-3') Authors: Sich, C, Ohlenschlager, O, Ramachandran, R, Gorlach, M, Brown, L.R. Deposit date: 1997-08-12 Release date: 1998-02-25 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structure of an RNA hairpin loop with a 5'-CGUUUCG-3' loop motif by heteronuclear NMR spectroscopy and distance geometry. Biochemistry, 36, 1997
2LQZ	Structure of the RNA claw of the DNA packaging motor of bacteriophage 29 Descriptor: RNA (27-MER) Authors: Harjes, E.J, Matsuo, H.J, Kitamura, A.J. Deposit date: 2012-03-19 Release date: 2012-08-01 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure of the RNA claw of the DNA packaging motor of bacteriophage 29. Nucleic Acids Res., 40, 2012
2MER	Structure of helix 69 from escherichia coli 23s ribosomal rna Descriptor: RNA_(5'-R(P*GP*GP*CP*CP*GP*(PSU)P*AP*AP*CP*(PSU)P*AP*(PSU)P*AP*AP*CP*GP*GP*UP*C)-3') Authors: Jiang, J, Aduri, R, Chow, C.S, Santalucia, J. Deposit date: 2013-09-26 Release date: 2014-01-01 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structure modulation of helix 69 from Escherichia coli 23S ribosomal RNA by pseudouridylations. Nucleic Acids Res., 42, 2014
1DQH	CRYSTAL STRUCTURE OF HELIX II OF THE X. LAEVIS SOMATIC 5S RRNA WITH A CYTOSINE BULGE IN TWO CONFORMATIONS Descriptor: RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)-3'), RNA (5'-R(*GP*CP*CP*AP*CP*CP*CP*UP*G)-3') Authors: Xiong, Y, Sundaralingam, M. Deposit date: 2000-01-04 Release date: 2000-11-13 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Two crystal forms of helix II of Xenopus laevis 5S rRNA with a cytosine bulge. RNA, 6, 2000
2M39	The solution structure of 3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX Descriptor: RNA (5'-R(*(C5L)P*(G48)P*(C5L)P*(G48)P*(A44)P*(A44)P*(T39)P*(T39)P*(C5L)P*(G48)P*(C5L)P*DG)-3') Authors: Plevnik, M, Cevec, M, Plavec, J. Deposit date: 2013-01-15 Release date: 2013-11-27 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: NMR structure of 2'-O-(2-methoxyethyl) modified and C5-methylated RNA dodecamer duplex. Biochimie, 95, 2013
2LVY	Solution Structure of a RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification Descriptor: RNA (5'-R(*CP*GP*CP*(UPV)P*AP*CP*GP*CP*T)-3'), RNA (5'-R(*GP*CP*GP*UP*AP*GP*CP*GP*T)-3') Authors: Baraguey, C. Deposit date: 2012-07-13 Release date: 2013-04-10 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: The biolabile 2'-O-pivaloyloxymethyl modification in an RNA helix: an NMR solution structure. Org.Biomol.Chem., 11, 2013
7EDU	RNA duplex containing C-Au-C base pair Descriptor: GOLD ION, RNA (5'-R(*GP*GP*AP*CP*UP*CP*GP*AP*CP*UP*CP*C)-3') Authors: Kondo, J, Iwase, E. Deposit date: 2021-03-17 Release date: 2022-03-23 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (2.3 Å) Cite: RNA duplex containing C-Au-C base pair To Be Published
2MQT	Solution NMR structure of the U5-primer binding site (U5-PBS) domain of murine leukemia virus RNA genome Descriptor: RNA (68-MER) Authors: D'Souza, V, Yildiz, Z. Deposit date: 2014-06-26 Release date: 2014-09-10 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing. Nature, 515, 2014
2LKR	Yeast U2/U6 complex Descriptor: RNA (111-MER) Authors: Burke, J.E, Sashital, D.G, Zuo, X, Wang, Y, Butcher, S.E. Deposit date: 2011-10-19 Release date: 2012-02-22 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure of the yeast U2/U6 snRNA complex. Rna, 18, 2012
1RAU	SOLUTION STRUCTURE OF AN UNUSUALLY STABLE RNA TETRAPLEX CONTAINING G-AND U-QUARTET STRUCTURES Descriptor: RNA (5'-R(*UP*GP*GP*GP*GP*U)-3') Authors: Cheong, C, Moore, P.B. Deposit date: 1993-07-29 Release date: 1994-01-31 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures. Biochemistry, 31, 1992
7M3V	RNA bulged-G motif Descriptor: IRIDIUM (III) ION, RNA (27-MER) Authors: Kondo, J, Sekiguchi, S. Deposit date: 2021-03-19 Release date: 2022-03-23 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (2.19 Å) Cite: RNA bulged-G motif To Be Published
5V0K	RNA duplex with 2-MeImpG analogue bound-3 binding sites Descriptor: 5'-O-[(S)-hydroxy(4-methyl-1H-imidazol-5-yl)phosphoryl]guanosine, MAGNESIUM ION, RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*C)-3') Authors: Zhang, W, Tam, C.P, Szostak, J.W. Deposit date: 2017-02-28 Release date: 2017-03-08 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (1.6 Å) Cite: RNA duplex with 2-MeImpG analogue bound-3 binding sites To Be Published
7ECJ	RNA duplex containing C-A base pairs Descriptor: DNA/RNA (5'-R(*GP*GP*AP*CP*U)-D(P*(CBR))-R(P*GP*AP*AP*UP*CP*C)-3') Authors: Kondo, J, Uchida, Y. Deposit date: 2021-03-12 Release date: 2022-03-16 Last modified: 2024-05-29 Method: X-RAY DIFFRACTION (3.1 Å) Cite: RNA duplex containing C-A base pairs To Be Published
7ECM	RNA duplex containing C-A base pair Descriptor: BARIUM ION, RNA (5'-R(*GP*GP*GP*CP*CP*CP*GP*GP*AP*CP*CP*C)-3') Authors: Kondo, J, Tsudura, A. Deposit date: 2021-03-12 Release date: 2022-03-16 Last modified: 2024-05-29 Method: X-RAY DIFFRACTION (1.51 Å) Cite: RNA duplex containing C-A base pair To Be Published
7ECK	RNA duplex containing C-Ag-A and U-Ag-A base pairs Descriptor: DNA/RNA (5'-R(*GP*GP*AP*CP*U)-D(P*(CBR))-R(P*GP*AP*AP*UP*CP*C)-3'), SILVER ION Authors: Kondo, J, Uchida, Y. Deposit date: 2021-03-12 Release date: 2022-03-16 Last modified: 2024-05-29 Method: X-RAY DIFFRACTION (2.79 Å) Cite: RNA duplex containing C-Ag-A and U-Ag-A base pairs To Be Published
7ECL	RNA duplex containing C-Ag-A and U-Ag-A base pair Descriptor: DNA/RNA (5'-R(*GP*GP*AP*CP*U)-D(P*(CBR))-R(P*GP*AP*AP*UP*CP*C)-3'), SILVER ION Authors: Kondo, J, Uchida, Y. Deposit date: 2021-03-12 Release date: 2022-03-16 Last modified: 2024-05-29 Method: X-RAY DIFFRACTION (3.01 Å) Cite: RNA duplex containing C-Ag-A and U-Ag-A base pair To Be Published
7EI7	RNA kink-turn motif with 2-aminopurine Descriptor: COBALT (II) ION, RNA (5'-R(*GP*GP*CP*GP*A)-D(P*(2PR))-R(P*GP*AP*AP*CP*CP*GP*GP*GP*GP*AP*GP*CP*C)-3') Authors: Kondo, J, Saisu, S. Deposit date: 2021-03-30 Release date: 2022-03-30 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3.2 Å) Cite: RNA kink-turn motif with 2-aminopurine To Be Published
7EEM	RNA bulged-G motif Descriptor: IRIDIUM ION, RNA (27-MER) Authors: Kondo, J, Sekiguchi, S. Deposit date: 2021-03-19 Release date: 2022-03-23 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (2.593 Å) Cite: RNA bulged-G motif To Be Published
7EIA	RNA kink-turn motif with pyrrolo cytosine Descriptor: POTASSIUM ION, RNA (5'-R(*GP*GP*CP*GP*A)-D(P*(4PC))-R(P*GP*AP*AP*CP*CP*GP*GP*GP*GP*AP*GP*CP*C)-3') Authors: Kondo, J, Miyauchi, T. Deposit date: 2021-03-30 Release date: 2022-03-30 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3 Å) Cite: RNA kink-turn motif with pyrrolo cytosine To Be Published
7EI8	RNA kink-turn motif with 2-aminopurine Descriptor: COBALT (II) ION, RNA (5'-R(*GP*GP*C)-D(P*(2PR)P*(2PR)P*(2PR)P*(2PR))-R(P*AP*AP*CP*CP*GP*GP*GP*GP*AP*GP*CP*C)-3') Authors: Kondo, J, Saisu, S. Deposit date: 2021-03-30 Release date: 2022-03-30 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3.1 Å) Cite: RNA kink-turn motif with 2-aminopurine To Be Published
7F8Z	RNA kink-turn motif with 2-aminopurine Descriptor: POTASSIUM ION, RNA (5'-R(*GP*GP*CP*GP*A)-D(P*(2PR))-R(P*GP*AP*AP*CP*CP*GP*GP*GP*GP*AP*GP*CP*C)-3') Authors: Kondo, J, Miyauchi, T. Deposit date: 2021-07-03 Release date: 2022-07-06 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3 Å) Cite: RNA kink-turn motif with 2-aminopurine To Be Published

<15161718192021222324252627282930>