PDB: 3956 resultsInfo pagesStatus searchChemie searchBIRD

---

1JUL	INDOLE-3-GLYCEROLPHOSPHATE SYNTHASE FROM SULFOLOBUS SOLFATARICUS IN A SECOND ORTHORHOMBIC CRYSTAL FORM Descriptor: 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, INDOLE-3-GLYCEROL PHOSPHATE SYNTHASE Authors: Knoechel, T.R, Hennig, M, Merz, A, Darimont, B, Kirschner, K, Jansonius, J.N. Deposit date: 1996-05-03 Release date: 1997-07-07 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2 Å) Cite: The crystal structure of indole-3-glycerol phosphate synthase from the hyperthermophilic archaeon Sulfolobus solfataricus in three different crystal forms: effects of ionic strength. J.Mol.Biol., 262, 1996
1JUK	INDOLE-3-GLYCEROLPHOSPHATE SYNTHASE FROM SULFOLOBUS SOLFATARICUS IN A TRIGONAL CRYSTAL FORM Descriptor: INDOLE-3-GLYCEROL PHOSPHATE SYNTHASE, SULFATE ION Authors: Knoechel, T.R, Hennig, M, Merz, A, Darimont, B, Kirschner, K, Jansonius, J.N. Deposit date: 1996-05-03 Release date: 1997-07-07 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2.5 Å) Cite: The crystal structure of indole-3-glycerol phosphate synthase from the hyperthermophilic archaeon Sulfolobus solfataricus in three different crystal forms: effects of ionic strength. J.Mol.Biol., 262, 1996
1SAX	Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA Descriptor: 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... Authors: Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. Deposit date: 2004-02-09 Release date: 2004-04-27 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.8 Å) Cite: On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
6KI7	Pyrophosphatase mutant K30R from Acinetobacter baumannii Descriptor: Inorganic pyrophosphatase Authors: Su, J. Deposit date: 2019-07-17 Release date: 2019-10-02 Last modified: 2024-03-27 Method: X-RAY DIFFRACTION (2.75 Å) Cite: Crystal Structures of Pyrophosphatase from Acinetobacter baumannii: Snapshots of Pyrophosphate Binding and Identification of a Phosphorylated Enzyme Intermediate. Int J Mol Sci, 20, 2019
1SF6	BINDING OF N,N',N"-TRIACETYLCHITOTRIOSE TO HEW LYSOZYME: A POWDER DIFFRACTION STUDY Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, LYSOZYME Authors: Von Dreele, R.B. Deposit date: 2004-02-19 Release date: 2004-03-02 Last modified: 2020-07-29 Method: POWDER DIFFRACTION Cite: Binding of N-acetylglucosamine oligosaccharides to hen egg-white lysozyme: a powder diffraction study. Acta Crystallogr.,Sect.D, 61, 2005
6K21	Pyrophosphatase from Acinetobacter baumannii Descriptor: Inorganic pyrophosphatase, MAGNESIUM ION, SODIUM ION Authors: Su, J. Deposit date: 2019-05-13 Release date: 2019-10-02 Last modified: 2024-03-27 Method: X-RAY DIFFRACTION (2 Å) Cite: Crystal Structures of Pyrophosphatase from Acinetobacter baumannii: Snapshots of Pyrophosphate Binding and Identification of a Phosphorylated Enzyme Intermediate. Int J Mol Sci, 20, 2019
6K27	Pyrophosphatase with PPi from Acinetobacter baumannii Descriptor: DIPHOSPHATE, Inorganic pyrophosphatase, MAGNESIUM ION Authors: Su, J. Deposit date: 2019-05-13 Release date: 2019-10-02 Last modified: 2024-03-27 Method: X-RAY DIFFRACTION (1.86 Å) Cite: Crystal Structures of Pyrophosphatase from Acinetobacter baumannii: Snapshots of Pyrophosphate Binding and Identification of a Phosphorylated Enzyme Intermediate. Int J Mol Sci, 20, 2019
6KI8	Pyrophosphatase mutant K149R from Acinetobacter baumannii Descriptor: DIPHOSPHATE, Inorganic pyrophosphatase, MAGNESIUM ION Authors: Su, J. Deposit date: 2019-07-17 Release date: 2019-10-02 Last modified: 2024-03-27 Method: X-RAY DIFFRACTION (1.79 Å) Cite: Crystal Structures of Pyrophosphatase from Acinetobacter baumannii: Snapshots of Pyrophosphate Binding and Identification of a Phosphorylated Enzyme Intermediate. Int J Mol Sci, 20, 2019
1DPW	STRUCTURE OF HEN EGG-WHITE LYSOZYME IN COMPLEX WITH MPD Descriptor: (4R)-2-METHYLPENTANE-2,4-DIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, CHLORIDE ION, ... Authors: Weiss, M.S, Palm, G.J, Hilgenfeld, R. Deposit date: 1999-12-28 Release date: 2000-01-03 Last modified: 2011-11-23 Method: X-RAY DIFFRACTION (1.64 Å) Cite: Crystallization, structure solution and refinement of hen egg-white lysozyme at pH 8.0 in the presence of MPD. Acta Crystallogr.,Sect.D, 56, 2000
1DPX	STRUCTURE OF HEN EGG-WHITE LYSOZYME Descriptor: CHLORIDE ION, LYSOZYME Authors: Weiss, M.S, Palm, G.J, Hilgenfeld, R. Deposit date: 1999-12-28 Release date: 2000-01-03 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (1.65 Å) Cite: Crystallization, structure solution and refinement of hen egg-white lysozyme at pH 8.0 in the presence of MPD. Acta Crystallogr.,Sect.D, 56, 2000
3ORC	CRYSTAL STRUCTURE OF AN ENGINEERED CRO MONOMER BOUND NONSPECIFICALLY TO DNA Descriptor: DNA (5'-D(*TP*AP*TP*CP*GP*AP*TP*A)-3'), PROTEIN (CRO REPRESSOR) Authors: Albright, R.A, Mossing, M.C, Matthews, B.W. Deposit date: 1998-04-23 Release date: 1998-12-02 Last modified: 2023-08-02 Method: X-RAY DIFFRACTION (3 Å) Cite: Crystal structure of an engineered Cro monomer bound nonspecifically to DNA: possible implications for nonspecific binding by the wild-type protein. Protein Sci., 7, 1998
2WPV	Crystal structure of S. cerevisiae Get4-Get5 complex Descriptor: MERCURY (II) ION, UBIQUITIN-LIKE PROTEIN MDY2, UPF0363 PROTEIN YOR164C Authors: Chang, Y.-W, Chuang, Y.-C, Ho, Y.-C, Cheng, M.-Y, Sun, Y.-J, Hsiao, C.-D, Wang, C. Deposit date: 2009-08-11 Release date: 2010-01-26 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (1.99 Å) Cite: Crystal Structure of Get4-Get5 Complex and its Interactions with Sgt2, Get3, and Ydj1. J.Biol.Chem., 285, 2010
5DLP	Acetylcholinesterase Methylene Blue no PEG Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, 3,7-BIS(DIMETHYLAMINO)PHENOTHIAZIN-5-IUM, Acetylcholinesterase, ... Authors: Dym, O. Deposit date: 2015-09-07 Release date: 2016-03-30 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (2.7 Å) Cite: The impact of crystallization conditions on structure-based drug design: A case study on the methylene blue/acetylcholinesterase complex. Protein Sci., 25, 2016
3PYK	Human Carbonic Anhydrase II as Host for Pianostool Complexes Bearing a Sulfonamide Anchor Descriptor: Carbonic anhydrase 2, METHYL MERCURY ION, SULFATE ION, ... Authors: Heinisch, T, Schirmer, T. Deposit date: 2010-12-13 Release date: 2011-07-13 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (1.3 Å) Cite: Human Carbonic Anhydrase II as a host for piano-stool complexes bearing a sulfonamide anchor. Chem.Commun.(Camb.), 47, 2011
5E2I	Acetylcholinesterase Methylene Blue no PEG Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, Acetylcholinesterase, DECAMETHONIUM ION, ... Authors: Dym, O. Deposit date: 2015-10-01 Release date: 2016-03-30 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (2.65 Å) Cite: The impact of crystallization conditions on structure-based drug design: A case study on the methylene blue/acetylcholinesterase complex. Protein Sci., 25, 2016
9F17	Crystal structure of N term His-tag Adenylosuccinate synthetase from Helicobacter pylori Descriptor: Adenylosuccinate synthetase, CALCIUM ION, GLYCEROL, ... Authors: Stefanic, Z. Deposit date: 2024-04-18 Release date: 2024-09-04 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Location Is Everything: Influence of His-Tag Fusion Site on Properties of Adenylosuccinate Synthetase from Helicobacter pylori. Int J Mol Sci, 25, 2024
1IF7	Carbonic Anhydrase II Complexed With (R)-N-(3-Indol-1-yl-2-methyl-propyl)-4-sulfamoyl-benzamide Descriptor: (R)-N-(3-INDOL-1-YL-2-METHYL-PROPYL)-4-SULFAMOYL-BENZAMIDE, CARBONIC ANHYDRASE II, MERCURY (II) ION, ... Authors: Grzybowski, B.A, Ishchenko, A.V, Kim, C.-Y, Topalov, G, Chapman, R, Christianson, D.W, Whitesides, G.M, Shakhnovich, E.I. Deposit date: 2001-04-12 Release date: 2001-05-02 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (1.98 Å) Cite: Combinatorial computational method gives new picomolar ligands for a known enzyme. Proc.Natl.Acad.Sci.USA, 99, 2002
1ILT	X-RAY STRUCTURE OF INTERLEUKIN-1 RECEPTOR ANTAGONIST AT 2.0 ANGSTROMS RESOLUTION Descriptor: INTERLEUKIN-1 RECEPTOR ANTAGONIST Authors: Brandhuber, B.J, Vigers, G.P.A. Deposit date: 1994-03-09 Release date: 1995-04-01 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2 Å) Cite: X-ray structure of interleukin-1 receptor antagonist at 2.0-A resolution. J.Biol.Chem., 269, 1994
4V6B	Crystal structure of human ferritin Phe167SerfsX26 mutant. Descriptor: CALCIUM ION, Ferritin Authors: Hurley, T.D, Vidal, R. Deposit date: 2009-06-19 Release date: 2014-07-09 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.85 Å) Cite: Unraveling of the E-helices and disruption of 4-fold pores are associated with iron mishandling in a mutant ferritin causing neurodegeneration J.Biol.Chem., 285, 2010
4P9A	X-ray Crystal Structure of PA protein from Influenza strain H7N9 Descriptor: GLYCEROL, Polymerase PA Authors: Fairman, J.W, Moen, S.O, Clifton, M.C, Edwards, T.E, Lorimer, D, Seattle Structural Genomics Center for Infectious Disease (SSGCID) Deposit date: 2014-04-02 Release date: 2014-07-30 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.1999 Å) Cite: Structural analysis of H1N1 and H7N9 influenza A virus PA in the absence of PB1. Sci Rep, 4, 2014
4AT9	Crystal structure of the NF90-NF45 dimerisation domain complex with UTP Descriptor: INTERLEUKIN ENHANCER-BINDING FACTOR 2, INTERLEUKIN ENHANCER-BINDING FACTOR 3, MAGNESIUM ION, ... Authors: Wolkowicz, U.M, Cook, A.G. Deposit date: 2012-05-05 Release date: 2012-08-01 Last modified: 2023-12-20 Method: X-RAY DIFFRACTION (2.803 Å) Cite: NF45 Dimerizes with NF90, Zfr and Spnr Via a Conserved Domain that Has a Nucleotidyltransferase Fold. Nucleic Acids Res., 40, 2012
2ROT	Structure of chimeric variant of SH3 domain- SHH Descriptor: Spectrin alpha chain, brain Authors: Kutyshenko, N.P, Prokhorov, D.A, Timchenko, M.A, Kudrevatykh, Y.A, Gushchina, L.V, Khristoforov, V.S, Filimonov, V.V. Deposit date: 2008-04-10 Release date: 2009-04-28 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution structure and dynamics of the chimeric SH3 domains, SHH- and SHA-"Bergeracs". Biochim.Biophys.Acta, 1794, 2009
5ZDS	Crystal structure of the second PDZ domain of Frmpd2 Descriptor: FERM and PDZ domain-containing 2 Authors: Lu, X, Wang, X.F. Deposit date: 2018-02-24 Release date: 2019-02-27 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.8 Å) Cite: The second PDZ domain of scaffold protein Frmpd2 binds to GluN2A of NMDA receptors. Biochem.Biophys.Res.Commun., 516, 2019
2RI4	Crystal Structure determination of Goat Methemoglobin at 2.7 Angstrom Descriptor: Hemoglobin subunit alpha-1/2, Hemoglobin subunit beta-A, PROTOPORPHYRIN IX CONTAINING FE Authors: Sathya Moorthy, P, Neelagandan, K, Balasubramanian, M, Ponnuswamy, M.N. Deposit date: 2007-10-10 Release date: 2008-10-14 Last modified: 2023-10-25 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Crystal Structure determination of Goat Methemoglobin at 2.7 Angstrom To be Published
6A5Q	Structure of 14-3-3 beta in complex with TFEB 14-3-3 binding motif Descriptor: 14-3-3 protein beta/alpha, MALONIC ACID, TFEB pS211-peptide Authors: Xu, Y, Ren, J.Q, Feng, W. Deposit date: 2018-06-25 Release date: 2019-02-13 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (2 Å) Cite: YWHA/14-3-3 proteins recognize phosphorylated TFEB by a noncanonical mode for controlling TFEB cytoplasmic localization. Autophagy, 15, 2019

<11121314151617181920212223242526>