PDB: 815 resultsInfo pagesStatus searchChemie searchBIRD

---

1M18	LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA Descriptor: Histone H2A.1, Histone H2B.1, Histone H3.2, ... Authors: Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. Deposit date: 2002-06-18 Release date: 2003-02-18 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.45 Å) Cite: Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
1M19	LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA Descriptor: 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... Authors: Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. Deposit date: 2002-06-18 Release date: 2003-02-18 Last modified: 2023-11-15 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
6M4D	Structural mechanism of nucleosome dynamics governed by human histone variants H2A.B and H2A.Z.2.2 Descriptor: DNA (125-MER), Histone H2A.V, Histone H2B type 2-E, ... Authors: Zhou, M, Dai, L.C, Li, C.M, Shi, L.X, Huang, Y, Guo, Z.Q. Deposit date: 2020-03-06 Release date: 2020-09-23 Last modified: 2024-03-27 Method: ELECTRON MICROSCOPY (4.4 Å) Cite: Structural basis of nucleosome dynamics modulation by histone variants H2A.B and H2A.Z.2.2. Embo J., 40, 2021
6MUP	CENP-A nucleosome bound by two copies of CENP-C(CD) and two copies CENP-N(NT) Descriptor: Centromere protein C, Centromere protein N, DNA (147-MER), ... Authors: Allu, P.K, Black, B.E. Deposit date: 2018-10-23 Release date: 2019-07-24 Last modified: 2024-03-13 Method: ELECTRON MICROSCOPY (3.5 Å) Cite: Structure of the Human Core Centromeric Nucleosome Complex. Curr.Biol., 29, 2019
8F86	SIRT6 bound to an H3K9Ac nucleosome Descriptor: DNA (148-MER), Histone H2A type 1, Histone H2B, ... Authors: Markert, J, Whedon, S, Wang, Z, Cole, P, Farnung, L. Deposit date: 2022-11-21 Release date: 2023-04-05 Last modified: 2024-03-13 Method: ELECTRON MICROSCOPY (3.1 Å) Cite: Structural Basis of Sirtuin 6-Catalyzed Nucleosome Deacetylation. J.Am.Chem.Soc., 145, 2023
8EUJ	Class2 of the INO80-Nucleosome complex Descriptor: DNA (147-MER), Histone H2A type 1, Histone H2B 1.1, ... Authors: Wu, H, Munoz, E, Gourdet, M, Narlikar, G, Cheng, Y.F. Deposit date: 2022-10-18 Release date: 2023-07-12 Last modified: 2024-05-29 Method: ELECTRON MICROSCOPY (3.36 Å) Cite: Reorientation of INO80 on hexasomes reveals basis for mechanistic versatility. Science, 381, 2023
8ETT	Class1 of the INO80-Hexasome complex Descriptor: DNA (110-MER), Histone H2A type 1, Histone H2B 1.1, ... Authors: Wu, H, Munoz, E, Gourdet, M, Cheng, Y.F, Narlikar, G. Deposit date: 2022-10-17 Release date: 2023-07-12 Last modified: 2024-04-03 Method: ELECTRON MICROSCOPY (6.68 Å) Cite: Reorientation of INO80 on hexasomes reveals basis for mechanistic versatility. Science, 381, 2023
8ETV	Class2 of the INO80-Hexasome complex Descriptor: DNA (110-MER), Histone H2A type 1, Histone H2B 1.1, ... Authors: Wu, H, Munoz, E, Gourdet, M, Cheng, Y.F, Narlikar, G. Deposit date: 2022-10-17 Release date: 2023-07-12 Last modified: 2024-04-03 Method: ELECTRON MICROSCOPY (3.16 Å) Cite: Reorientation of INO80 on hexasomes reveals basis for mechanistic versatility. Science, 381, 2023
8EU2	Class3 of the INO80-Hexasome complex Descriptor: DNA (110-MER), Histone H2A type 1, Histone H2B 1.1, ... Authors: Wu, H, Munoz, E, Gourdet, M, Cheng, Y.F, Narlikar, G. Deposit date: 2022-10-18 Release date: 2023-07-12 Last modified: 2024-04-03 Method: ELECTRON MICROSCOPY (2.93 Å) Cite: Reorientation of INO80 on hexasomes reveals basis for mechanistic versatility. Science, 381, 2023
7T7T	Structure of TSK/BRU1 bound to histone H3.1 Descriptor: Histone H3.1, Protein TONSOKU Authors: Davarinejad, H, Couture, J.F. Deposit date: 2021-12-15 Release date: 2022-03-30 Method: X-RAY DIFFRACTION (3.17 Å) Cite: The histone H3.1 variant regulates TONSOKU-mediated DNA repair during replication. Science, 375, 2022
8EUE	Class1 of the INO80-Nucleosome complex Descriptor: DNA (147-MER), Histone H2A type 1, Histone H2B 1.1, ... Authors: Wu, H, Munoz, E, Gourdet, M, Narlikar, G, Cheng, Y.F. Deposit date: 2022-10-18 Release date: 2023-07-12 Last modified: 2024-04-03 Method: ELECTRON MICROSCOPY (3.48 Å) Cite: Reorientation of INO80 on hexasomes reveals basis for mechanistic versatility. Science, 381, 2023
8F0X	Cryo-EM structure of Kap114 bound to H2A-H2B Descriptor: Histone H2A.2, Histone H2B.2, Importin subunit beta-5 Authors: Jiou, J, Chook, Y.M. Deposit date: 2022-11-04 Release date: 2023-07-26 Last modified: 2024-06-19 Method: ELECTRON MICROSCOPY (3.21 Å) Cite: Mechanism of RanGTP priming H2A-H2B release from Kap114 in an atypical RanGTP•Kap114•H2A-H2B complex. Proc.Natl.Acad.Sci.USA, 120, 2023
8EVG	162bp CX3CR1 nucleosome (further classified with better nucleosome end) Descriptor: DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... Authors: Tengfei, L, Ruifang, G, Yawen, B. Deposit date: 2022-10-20 Release date: 2023-11-01 Method: ELECTRON MICROSCOPY (2.75 Å) Cite: Structural basis of cooperative targeting of the CX3CR1 nucleosome To Be Published
8EVJ	CX3CR1 nucleosome bound PU.1 and C/EBPa Descriptor: DNA (167-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... Authors: Guan, R, Bai, Y, Lian, T. Deposit date: 2022-10-20 Release date: 2023-11-01 Last modified: 2024-05-01 Method: ELECTRON MICROSCOPY (4.1 Å) Cite: Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha. Nat.Struct.Mol.Biol., 31, 2024
8EVI	CX3CR1 nucleosome and PU.1 complex containing disulfide bond mutations Descriptor: DNA (167-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... Authors: Lian, T, Guan, R, Bai, Y. Deposit date: 2022-10-20 Release date: 2023-11-01 Last modified: 2024-05-01 Method: ELECTRON MICROSCOPY (2.64 Å) Cite: Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha. Nat.Struct.Mol.Biol., 31, 2024
8EVH	CX3CR1 nucleosome and wild type PU.1 complex Descriptor: DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... Authors: Lian, T, Guan, R, Bai, Y. Deposit date: 2022-10-20 Release date: 2023-11-01 Last modified: 2024-05-01 Method: ELECTRON MICROSCOPY (2.85 Å) Cite: Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha. Nat.Struct.Mol.Biol., 31, 2024
6MUO	CENP-A nucleosome bound by two copies of CENP-C(CD) and one copy CENP-N(NT) Descriptor: Centromere protein C, Centromere protein N, DNA/RNA (147-MER), ... Authors: Allu, P.K, Black, B.E. Deposit date: 2018-10-23 Release date: 2019-07-24 Last modified: 2024-03-13 Method: ELECTRON MICROSCOPY (3.6 Å) Cite: Structure of the Human Core Centromeric Nucleosome Complex. Curr.Biol., 29, 2019
6N1Z	Importin-9 bound to H2A-H2B Descriptor: Histone H2A, Histone H2B 1.1, Importin-9 Authors: Tomchick, D.R, Chook, Y.M, Padavannil, A. Deposit date: 2018-11-12 Release date: 2019-03-20 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Importin-9 wraps around the H2A-H2B core to act as nuclear importer and histone chaperone. Elife, 8, 2019
6NE3	Cryo-EM structure of singly-bound SNF2h-nucleosome complex with SNF2h bound at SHL-2 Descriptor: ADENOSINE-5'-DIPHOSPHATE, DNA (156-MER), Histone H2A type 1, ... Authors: Armache, J.-P, Gamarra, N, Johnson, S.L, Leonard, J.D, Wu, S, Narlikar, G.N, Cheng, Y. Deposit date: 2018-12-16 Release date: 2019-07-17 Last modified: 2024-03-20 Method: ELECTRON MICROSCOPY (3.9 Å) Cite: Cryo-EM structures of remodeler-nucleosome intermediates suggest allosteric control through the nucleosome. Elife, 8, 2019
7U0J	Structure of 162bp LIN28b nucleosome Descriptor: DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... Authors: Lian, T, Guan, R, Bai, Y. Deposit date: 2022-02-18 Release date: 2023-06-28 Method: ELECTRON MICROSCOPY (2.7 Å) Cite: Structural mechanism of LIN28B nucleosome targeting by OCT4. Mol.Cell, 83, 2023
7TN2	Composite model of a Chd1-nucleosome complex in the nucleotide-free state derived from 2.3A and 2.7A Cryo-EM maps Descriptor: Chromo domain-containing protein 1, DNA Lagging Strand, DNA Tracking Strand, ... Authors: Nodelman, I.M, Bowman, G.D, Armache, J.-P. Deposit date: 2022-01-20 Release date: 2022-03-02 Last modified: 2024-02-21 Method: ELECTRON MICROSCOPY (2.3 Å) Cite: Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
7U46	Cryo-EM structure of CENP-A nucleosome (palindromic alpha satellite DNA) in complex with CENP-N Descriptor: Centromere protein N, DNA (147-MER), Histone H2A, ... Authors: Zhou, K, Luger, K. Deposit date: 2022-02-28 Release date: 2022-03-16 Last modified: 2024-02-21 Method: ELECTRON MICROSCOPY (2.68 Å) Cite: CENP-N promotes the compaction of centromeric chromatin. Nat.Struct.Mol.Biol., 29, 2022
7U47	CryoEM structure of CENP-N promoted nucleosome stacks with CENP-A and palindromic alpha satellite DNA sequence Descriptor: Centromere protein N, DNA (147-MER), Histone H2A, ... Authors: Zhou, K, Luger, K. Deposit date: 2022-02-28 Release date: 2022-03-16 Last modified: 2024-02-21 Method: ELECTRON MICROSCOPY (7.5 Å) Cite: CENP-N promotes the compaction of centromeric chromatin. Nat.Struct.Mol.Biol., 29, 2022
7SWY	2.6 A structure of a 40-601[TA-rich+1]-40 nucleosome Descriptor: DNA Guide Strand, DNA Tracking Strand, Histone H2A, ... Authors: Nodelman, I.M, Bowman, G.D, Armache, J.-P. Deposit date: 2021-11-21 Release date: 2022-03-02 Last modified: 2024-06-05 Method: ELECTRON MICROSCOPY (2.6 Å) Cite: Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
1KX3	X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution Descriptor: DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... Authors: Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. Deposit date: 2002-01-31 Release date: 2002-12-25 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (2 Å) Cite: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002

<45678910111213141516171819>