1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
7Z90
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7z90 by Molmil](/molmil-images/mine/7z90) | |
7MY5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7my5 by Molmil](/molmil-images/mine/7my5) | The crystal structure of wild type PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000988503 | Descriptor: | 5-hydroxy-N-[2-(4-hydroxy-3-methoxyphenyl)ethyl]-2-(2-methylphenyl)-6-oxo-1,6-dihydropyrimidine-4-carboxamide, Hexa Vinylpyrrolidone K15, MANGANESE (II) ION, ... | Authors: | Cuypers, M.G, Slavish, J.P, Rankovic, Z, White, S.W. | Deposit date: | 2021-05-20 | Release date: | 2022-05-25 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.38 Å) | Cite: | The crystal structure of wild type PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000988503 To Be Published
|
|
1FJE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fje by Molmil](/molmil-images/mine/1fje) | SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA | Descriptor: | NUCLEOLIN RBD12, SNRE RNA | Authors: | Allain, F.H.T, Bouvet, P, Dieckmann, T, Feigon, J. | Deposit date: | 2000-08-08 | Release date: | 2001-01-03 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Molecular basis of sequence-specific recognition of pre-ribosomal RNA by nucleolin. EMBO J., 19, 2000
|
|
2ZVM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2zvm by Molmil](/molmil-images/mine/2zvm) | Crystal structure of PCNA in complex with DNA polymerase iota fragment | Descriptor: | DNA polymerase iota, Proliferating cell nuclear antigen | Authors: | Hishiki, A, Hashimoto, H, Hanafusa, T, Kamei, K, Ohashi, E, Shimizu, T, Ohmori, H, Sato, M. | Deposit date: | 2008-11-11 | Release date: | 2009-02-10 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structural Basis for Novel Interactions between Human Translesion Synthesis Polymerases and Proliferating Cell Nuclear Antigen J.Biol.Chem., 284, 2009
|
|
3H98
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3h98 by Molmil](/molmil-images/mine/3h98) | Crystal structure of HCV NS5b 1b with (1,1-dioxo-2H-[1,2,4]benzothiadiazin-3-yl) azolo[1,5-a]pyrimidine derivative | Descriptor: | GLYCEROL, N-{3-[5-hydroxy-8-(3-methylbutyl)-7-oxo-7,8-dihydroimidazo[1,2-a]pyrimidin-6-yl]-1,1-dioxido-4H-1,2,4-benzothiadiazin-7-yl}methanesulfonamide, RNA-directed RNA polymerase | Authors: | Wang, G, Lei, H, Wang, X, Das, D, Mackinnon, C, Montalbetti, C.A.G, Mears, R, Gai, X, Bailey, S, Ruhrmund, D, Hooi, L, Misialek, S, Rajagopalan, R, Cheng, R.K.Y, Barker, J.L, Felicetti, B, Stoycheva, A, Buckman, B, Kossen, K, Seiwert, S, Beigelmana, L. | Deposit date: | 2009-04-30 | Release date: | 2009-10-13 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | HCV NS5B polymerase inhibitors 2: Synthesis and in vitro activity of (1,1-dioxo-2H-[1,2,4]benzothiadiazin-3-yl) azolo[1,5-a]pyridine and azolo[1,5-a]pyrimidine derivatives. Bioorg.Med.Chem.Lett., 19, 2009
|
|
1L9A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1l9a by Molmil](/molmil-images/mine/1l9a) | CRYSTAL STRUCTURE OF SRP19 IN COMPLEX WITH THE S DOMAIN OF SIGNAL RECOGNITION PARTICLE RNA | Descriptor: | MAGNESIUM ION, METHYL MERCURY ION, SIGNAL RECOGNITION PARTICLE 19 KDA PROTEIN, ... | Authors: | Oubridge, C, Kuglstatter, A, Jovine, L, Nagai, K. | Deposit date: | 2002-03-22 | Release date: | 2002-06-28 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of SRP19 in complex with the S domain of SRP RNA and its implication for the assembly of the signal recognition particle. Mol.Cell, 9, 2002
|
|
6HAY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6hay by Molmil](/molmil-images/mine/6hay) | Crystal structure of PROTAC 1 in complex with the bromodomain of human SMARCA2 and pVHL:ElonginC:ElonginB | Descriptor: | (2~{S},4~{R})-~{N}-[[2-[2-[2-[2-[4-[3-azanyl-6-(2-hydroxyphenyl)pyridazin-4-yl]piperazin-1-yl]ethoxy]ethoxy]ethoxy]-4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl]-1-[(2~{S})-2-[(1-fluoranylcyclopropyl)carbonylamino]-3,3-dimethyl-butanoyl]-4-oxidanyl-pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | Authors: | Roy, M, Bader, G, Diers, E, Trainor, N, Farnaby, W, Ciulli, A. | Deposit date: | 2018-08-09 | Release date: | 2019-06-12 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.24 Å) | Cite: | BAF complex vulnerabilities in cancer demonstrated via structure-based PROTAC design. Nat.Chem.Biol., 15, 2019
|
|
7TNY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tny by Molmil](/molmil-images/mine/7tny) | Cryo-EM structure of RIG-I in complex with p2dsRNA | Descriptor: | Antiviral innate immune response receptor RIG-I, ZINC ION, p2dsRNA | Authors: | Wang, W, Pyle, A.M. | Deposit date: | 2022-01-22 | Release date: | 2022-11-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | The RIG-I receptor adopts two different conformations for distinguishing host from viral RNA ligands. Mol.Cell, 82, 2022
|
|
7TNX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tnx by Molmil](/molmil-images/mine/7tnx) | Cryo-EM structure of RIG-I in complex with p3dsRNA | Descriptor: | Antiviral innate immune response receptor RIG-I, ZINC ION, p3dsRNAa, ... | Authors: | Wang, W, Pyle, A.M. | Deposit date: | 2022-01-22 | Release date: | 2022-11-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.54 Å) | Cite: | The RIG-I receptor adopts two different conformations for distinguishing host from viral RNA ligands. Mol.Cell, 82, 2022
|
|
7TO0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7to0 by Molmil](/molmil-images/mine/7to0) | Cryo-EM structure of RIG-I in complex with OHdsRNA | Descriptor: | Antiviral innate immune response receptor RIG-I, OHdsRNA, ZINC ION | Authors: | Wang, W, Pyle, A.M. | Deposit date: | 2022-01-22 | Release date: | 2022-11-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | The RIG-I receptor adopts two different conformations for distinguishing host from viral RNA ligands. Mol.Cell, 82, 2022
|
|
7TNZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tnz by Molmil](/molmil-images/mine/7tnz) | Cryo-EM structure of RIG-I in complex with p1dsRNA | Descriptor: | Antiviral innate immune response receptor RIG-I, ZINC ION, p1dsRNA | Authors: | Wang, W, Pyle, A.M. | Deposit date: | 2022-01-22 | Release date: | 2022-11-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.54 Å) | Cite: | The RIG-I receptor adopts two different conformations for distinguishing host from viral RNA ligands. Mol.Cell, 82, 2022
|
|
6HR2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6hr2 by Molmil](/molmil-images/mine/6hr2) | Crystal structure of PROTAC 2 in complex with the bromodomain of human SMARCA4 and pVHL:ElonginC:ElonginB | Descriptor: | (2~{S},4~{R})-~{N}-[[2-[2-[4-[[4-[3-azanyl-6-(2-hydroxyphenyl)pyridazin-4-yl]piperazin-1-yl]methyl]phenyl]ethoxy]-4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl]-1-[(2~{S})-2-[(1-fluoranylcyclopropyl)carbonylamino]-3,3-dimethyl-butanoyl]-4-oxidanyl-pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, DIMETHYL SULFOXIDE, ... | Authors: | Roy, M, Bader, G, Diers, E, Trainor, N, Farnaby, W, Ciulli, A. | Deposit date: | 2018-09-26 | Release date: | 2019-06-12 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | BAF complex vulnerabilities in cancer demonstrated via structure-based PROTAC design. Nat.Chem.Biol., 15, 2019
|
|
3OWG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3owg by Molmil](/molmil-images/mine/3owg) | Crystal structure of vaccinia virus Polyadenylate polymerase(vp55) | Descriptor: | Poly(A) polymerase catalytic subunit | Authors: | Li, C, Li, H, Zhou, S, Gershon, P.D, Poulos, T.L. | Deposit date: | 2010-09-17 | Release date: | 2011-09-21 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Domain-level rocking motion within a polymerase that translocates on single-stranded nucleic acid. Acta Crystallogr.,Sect.D, 69, 2013
|
|
6HAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6hax by Molmil](/molmil-images/mine/6hax) | Crystal structure of PROTAC 2 in complex with the bromodomain of human SMARCA2 and pVHL:ElonginC:ElonginB | Descriptor: | (2~{S},4~{R})-~{N}-[[2-[2-[4-[[4-[3-azanyl-6-(2-hydroxyphenyl)pyridazin-4-yl]piperazin-1-yl]methyl]phenyl]ethoxy]-4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl]-1-[(2~{S})-2-[(1-fluoranylcyclopropyl)carbonylamino]-3,3-dimethyl-butanoyl]-4-oxidanyl-pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | Authors: | Roy, M, Bader, G, Diers, E, Trainor, N, Farnaby, W, Ciulli, A. | Deposit date: | 2018-08-09 | Release date: | 2019-06-12 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | BAF complex vulnerabilities in cancer demonstrated via structure-based PROTAC design. Nat.Chem.Biol., 15, 2019
|
|
7PLR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7plr by Molmil](/molmil-images/mine/7plr) | Crystal structure of the N-terminal endonuclease domain of La Crosse virus L-protein bound to compound Baloxavir | Descriptor: | Baloxavir acid, FORMIC ACID, GLYCEROL, ... | Authors: | Feracci, M, Hernandez, S, Vincentelli, R, Ferron, F, Reguera, J, Canard, B, Alvarez, K. | Deposit date: | 2021-09-01 | Release date: | 2022-09-14 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.64 Å) | Cite: | Crystal structure of the N-terminal endonuclease domain of La Crosse virus L-protein bound to compound Baloxavir To Be Published
|
|
1HAV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hav by Molmil](/molmil-images/mine/1hav) | HEPATITIS A VIRUS 3C PROTEINASE | Descriptor: | CHLORIDE ION, HEPATITIS A VIRUS 3C PROTEINASE | Authors: | Bergmann, E.M, James, M.N.G. | Deposit date: | 1996-10-23 | Release date: | 1996-12-23 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The refined crystal structure of the 3C gene product from hepatitis A virus: specific proteinase activity and RNA recognition. J.Virol., 71, 1997
|
|
7LP8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7lp8 by Molmil](/molmil-images/mine/7lp8) | The crystal structure of I38T mutant PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000983476 | Descriptor: | (phenylmethyl) (2~{S})-2-[5-oxidanyl-6-oxidanylidene-4-(2-pyridin-4-ylethylcarbamoyl)-1~{H}-pyrimidin-2-yl]pyrrolidine-1-carboxylate, Hexa Vinylpyrrolidone K15, MANGANESE (II) ION, ... | Authors: | Cuypers, M.G, Slavish, P.J, Rankovic, Z, White, S.W. | Deposit date: | 2021-02-11 | Release date: | 2022-02-16 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.55 Å) | Cite: | The crystal structure of I38T mutant PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000983476 To Be Published
|
|
7LP7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7lp7 by Molmil](/molmil-images/mine/7lp7) | The crystal structure of the wild type PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000983476 | Descriptor: | (phenylmethyl) (2~{S})-2-[5-oxidanyl-6-oxidanylidene-4-(2-pyridin-4-ylethylcarbamoyl)-1~{H}-pyrimidin-2-yl]pyrrolidine-1-carboxylate, Hexa Vinylpyrrolidone K15, MANGANESE (II) ION, ... | Authors: | Cuypers, M.G, Slavish, P.J, Rankovic, Z, White, S.W. | Deposit date: | 2021-02-11 | Release date: | 2022-02-16 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | The crystal structure of the wild type PA endonuclease (2009/H1N1/CALIFORNIA) in complex with SJ000983476 To Be Published
|
|
7UY8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7uy8 by Molmil](/molmil-images/mine/7uy8) | Tetrahymena Polymerase alpha-Primase | Descriptor: | DNA polymerase, DNA polymerase alpha subunit B, DNA primase, ... | Authors: | He, Y, Song, H, Chan, H, Wang, Y, Liu, B, Susac, L, Zhou, Z.H, Feigon, J. | Deposit date: | 2022-05-06 | Release date: | 2022-07-13 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (4.5 Å) | Cite: | Structure of Tetrahymena telomerase-bound CST with polymerase alpha-primase. Nature, 608, 2022
|
|
1UUD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1uud by Molmil](/molmil-images/mine/1uud) | NMR structure of a synthetic small molecule, rbt203, bound to HIV-1 TAR RNA | Descriptor: | N-[2-(2-{[(4-{[AMINO(IMINO)METHYL]AMINO}BUTYL)AMINO]METHYL}-4-METHOXYPHENOXY)ETHYL]GUANIDINE, RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*GP *CP*CP*UP*GP*GP*GP*AP*GP*CP*UP*CP*UP*CP*UP*GP*CP*C) -3') | Authors: | Davis, B, Afshar, M, Varani, G, Karn, J, Murchie, A.I.H, Lentzen, G, Drysdale, M.J, Potter, A.J, Bower, J, Aboul-Ela, F. | Deposit date: | 2003-12-18 | Release date: | 2004-03-15 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Rational Design of Inhibitors of HIV-1 Tar RNA Through the Stabilisation of Electrostatic "Hot Spots" J.Mol.Biol., 336, 2004
|
|
7SLQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7slq by Molmil](/molmil-images/mine/7slq) | Cryo-EM structure of 7SK core RNP with circular RNA | Descriptor: | 7SK snRNA methylphosphate capping enzyme, La-related protein 7, Minimal circular 7SK RNA, ... | Authors: | Yang, Y, Liu, S, Zhou, Z.H, Feigon, J. | Deposit date: | 2021-10-24 | Release date: | 2022-03-30 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Structural basis of RNA conformational switching in the transcriptional regulator 7SK RNP. Mol.Cell, 82, 2022
|
|
7SLP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7slp by Molmil](/molmil-images/mine/7slp) | Cryo-EM structure of 7SK core RNP with linear RNA | Descriptor: | 7SK snRNA methylphosphate capping enzyme, La-related protein 7, Linear 7SK RNA, ... | Authors: | Yang, Y, Liu, S, Zhou, Z.H, Feigon, J. | Deposit date: | 2021-10-24 | Release date: | 2022-03-30 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (4.1 Å) | Cite: | Structural basis of RNA conformational switching in the transcriptional regulator 7SK RNP. Mol.Cell, 82, 2022
|
|
7V2Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7v2z by Molmil](/molmil-images/mine/7v2z) | ZIKV NS3helicase in complex with ssRNA and ATP-Mn2+ | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Core protein, MANGANESE (II) ION, ... | Authors: | Lin, M.M, Yang, H.T. | Deposit date: | 2021-08-10 | Release date: | 2022-08-17 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.10101676 Å) | Cite: | Structural Basis of Zika Virus Helicase in RNA Unwinding and ATP Hydrolysis. Acs Infect Dis., 8, 2022
|
|
2W2H
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2w2h by Molmil](/molmil-images/mine/2w2h) | |