7DLL
 
 | | Short chain dehydrogenase 2 (SCR2) crystal structure with NADPH | | Descriptor: | (S)-specific carbonyl reductase, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | | Authors: | Li, Y.H, Zhang, R.Z, Forouhar, F, Wang, C, Montelione, G.T, Szyperski, T, Xu, Y, Hunt, J.F. | | Deposit date: | 2020-11-28 | | Release date: | 2022-04-06 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Oligomeric interactions maintain active-site structure in a noncooperative enzyme family.
Embo J., 41, 2022
|
|
3NQX
 | | Crystal structure of vibriolysin MCP-02 mature enzyme, a zinc metalloprotease from M4 family | | Descriptor: | CALCIUM ION, Secreted metalloprotease Mcp02, ZINC ION | | Authors: | Gao, X, Wang, J, Wu, J.-W, Zhang, Y.-Z. | | Deposit date: | 2010-06-30 | | Release date: | 2010-10-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the autoprocessing of zinc metalloproteases in the thermolysin family
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3NQZ
 | | Crystal structure of the autoprocessed Vibriolysin MCP-02 with E369A mutation | | Descriptor: | CALCIUM ION, Secreted metalloprotease Mcp02, ZINC ION | | Authors: | Gao, X, Wang, J, Chen, L, Wu, J.-W, Zhang, Y.-Z. | | Deposit date: | 2010-06-30 | | Release date: | 2010-10-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Structural basis for the autoprocessing of zinc metalloproteases in the thermolysin family
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3NQY
 | | Crystal structure of the autoprocessed complex of Vibriolysin MCP-02 with a single point mutation E346A | | Descriptor: | CALCIUM ION, Secreted metalloprotease Mcp02, ZINC ION | | Authors: | Gao, X, Wang, J, Wu, J.-W, Zhang, Y.-Z. | | Deposit date: | 2010-06-30 | | Release date: | 2010-10-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis for the autoprocessing of zinc metalloproteases in the thermolysin family
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
7EH3
 | |
7EL7
 | | NMR solution structure of the 1:1 complex of a quadruplex-duplex hybrid MYT1L and a platinum(II) ligand L1Pt(dien) | | Descriptor: | G-quadruplex DNA MYT1L, Pt(diethylenetriamine)(2-(pyridin-4-ylmethyl)benzo[lmn][3,8]phenanthroline-1,3,6,8(2H,7H)-tetraone) | | Authors: | Liu, L.-Y, Liu, W, Mao, Z.-W. | | Deposit date: | 2021-04-08 | | Release date: | 2021-12-15 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Spatial Matching Selectivity and Solution Structure of Organic-Metal Hybrid to Quadruplex-Duplex Hybrid.
Angew.Chem.Int.Ed.Engl., 60, 2021
|
|
8X35
 | | Neryl diphosphate synthase from Solanum lycopersicum complexed with DMSAPP, IPP, and magnesium ion (form A) | | Descriptor: | 1,2-ETHANEDIOL, 3-METHYLBUT-3-ENYL TRIHYDROGEN DIPHOSPHATE, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Imaizumi, R, Matsuura, H, Yanai, T, Takeshita, K, Misawa, S, Yamaguchi, H, Sakai, N, Miyagi-Inoue, Y, Suenaga-Hiromori, M, Kataoka, K, Nakayama, T, Yamamoto, M, Takahashi, S, Yamashita, S. | | Deposit date: | 2023-11-12 | | Release date: | 2024-02-07 | | Last modified: | 2024-04-24 | | Method: | X-RAY DIFFRACTION (1.92 Å) | | Cite: | Structural-Functional Correlations between Unique N-terminal Region and C-terminal Conserved Motif in Short-chain cis-Prenyltransferase from Tomato.
Chembiochem, 25, 2024
|
|
8X37
 | | Neryl diphosphate synthase from Solanum lycopersicum complexed with DMSAPP | | Descriptor: | DIMETHYLALLYL S-THIOLODIPHOSPHATE, MAGNESIUM ION, Neryl-diphosphate synthase 1 | | Authors: | Imaizumi, R, Matsuura, H, Yanai, T, Takeshita, K, Misawa, S, Yamaguchi, H, Sakai, N, Miyagi-Inoue, Y, Suenaga-Hiromori, M, Kataoka, K, Nakayama, T, Yamamoto, M, Takahashi, S, Yamashita, S. | | Deposit date: | 2023-11-12 | | Release date: | 2024-02-07 | | Last modified: | 2024-04-24 | | Method: | X-RAY DIFFRACTION (1.98 Å) | | Cite: | Structural-Functional Correlations between Unique N-terminal Region and C-terminal Conserved Motif in Short-chain cis-Prenyltransferase from Tomato.
Chembiochem, 25, 2024
|
|
8X36
 | | Neryl diphosphate synthase from Solanum lycopersicum complexed with DMSAPP, IPP, and magnesium ion (form B) | | Descriptor: | 3-METHYLBUT-3-ENYL TRIHYDROGEN DIPHOSPHATE, DIMETHYLALLYL S-THIOLODIPHOSPHATE, MAGNESIUM ION, ... | | Authors: | Imaizumi, R, Matsuura, H, Yanai, T, Takeshita, K, Misawa, S, Yamaguchi, H, Sakai, N, Miyagi-Inoue, Y, Suenaga-Hiromori, M, Kataoka, K, Nakayama, T, Yamamoto, M, Takahashi, S, Yamashita, S. | | Deposit date: | 2023-11-12 | | Release date: | 2024-02-07 | | Last modified: | 2024-04-24 | | Method: | X-RAY DIFFRACTION (2.28 Å) | | Cite: | Structural-Functional Correlations between Unique N-terminal Region and C-terminal Conserved Motif in Short-chain cis-Prenyltransferase from Tomato.
Chembiochem, 25, 2024
|
|
4A7F
 | | Structure of the Actin-Tropomyosin-Myosin Complex (rigor ATM 3) | | Descriptor: | ACTIN, ALPHA SKELETAL MUSCLE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Behrmann, E, Mueller, M, Penczek, P.A, Mannherz, H.G, Manstein, D.J, Raunser, S. | | Deposit date: | 2011-11-14 | | Release date: | 2012-08-01 | | Last modified: | 2017-08-30 | | Method: | ELECTRON MICROSCOPY (7.7 Å) | | Cite: | Structure of the Rigor Actin-Tropomyosin-Myosin Complex.
Cell(Cambridge,Mass.), 150, 2012
|
|
4E0R
 | | Structure of the chicken MHC class I molecule BF2*0401 | | Descriptor: | 8-MERIC PEPTIDE (FUS/TLS), Beta-2 microglobulin, MHC class I alpha chain 2 | | Authors: | Zhang, J, Chen, Y, Qi, J, Gao, F, Kaufman, J, Xia, C, Gao, G.F. | | Deposit date: | 2012-03-05 | | Release date: | 2012-11-21 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | Narrow Groove and Restricted Anchors of MHC Class I Molecule BF2*0401 Plus Peptide Transporter Restriction Can Explain Disease Susceptibility of B4 Chickens.
J.Immunol., 189, 2012
|
|
4A7L
 | | Structure of the Actin-Tropomyosin-Myosin Complex (rigor ATM 1) | | Descriptor: | ACTIN, ALPHA SKELETON MUSCLE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Behrmann, E, Mueller, M, Penczek, P.A, Mannherz, H.G, Manstein, D.J, Raunser, S. | | Deposit date: | 2011-11-14 | | Release date: | 2012-08-01 | | Last modified: | 2019-10-23 | | Method: | ELECTRON MICROSCOPY (8.1 Å) | | Cite: | Structure of the Rigor Actin-Tropomyosin-Myosin Complex.
Cell(Cambridge,Mass.), 150, 2012
|
|
4A7N
 | | Structure of bare F-actin filaments obtained from the same sample as the Actin-Tropomyosin-Myosin Complex | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, CALCIUM ION, F-ACTIN | | Authors: | Behrmann, E, Mueller, M, Penczek, P.A, Mannherz, H.G, Manstein, D.J, Raunser, S. | | Deposit date: | 2011-11-14 | | Release date: | 2012-08-01 | | Last modified: | 2017-08-30 | | Method: | ELECTRON MICROSCOPY (8.9 Å) | | Cite: | Structure of the Rigor Actin-Tropomyosin-Myosin Complex.
Cell(Cambridge,Mass.), 150, 2012
|
|
4A7H
 | | Structure of the Actin-Tropomyosin-Myosin Complex (rigor ATM 2) | | Descriptor: | ACTIN, ALPHA SKELETAL MUSCLE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Behrmann, E, Mueller, M, Penczek, P.A, Mannherz, H.G, Manstein, D.J, Raunser, S. | | Deposit date: | 2011-11-14 | | Release date: | 2012-08-01 | | Last modified: | 2017-08-30 | | Method: | ELECTRON MICROSCOPY (7.8 Å) | | Cite: | Structure of the Rigor Actin-Tropomyosin-Myosin Complex.
Cell(Cambridge,Mass.), 150, 2012
|
|
4B1Z
 | | Structure of the Phactr1 RPEL domain bound to G-actin | | Descriptor: | ACTIN, ALPHA SKELETAL MUSCLE, ADENOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Mouilleron, S, Wiezlak, M, O'Reilly, N, Treisman, R, McDonald, N.Q. | | Deposit date: | 2012-07-12 | | Release date: | 2012-11-07 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Structures of the Phactr1 RPEL domain and RPEL motif complexes with G-actin reveal the molecular basis for actin binding cooperativity.
Structure, 20, 2012
|
|
1SGT
 | |
4MCR
 | | A high resolution structure of human glutamate carboxypeptidase II (GCPII) in complex with folyltri-gamma-L-glutamic acid (pteroyltetra-gamma-L-glutamic acid) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, ... | | Authors: | Navratil, M, Barinka, C, Lubkowski, J. | | Deposit date: | 2013-08-21 | | Release date: | 2014-06-18 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Structural and biochemical characterization of the folyl-poly-gamma-l-glutamate hydrolyzing activity of human glutamate carboxypeptidase II.
Febs J., 281, 2014
|
|
1TIN
 | |
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FQ3
 | | CRYSTAL STRUCTURE OF HUMAN GRANZYME B | | Descriptor: | GRANZYME B, SULFATE ION, beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Estebanez-Perpina, E, Fuentes-Prior, P, Belorgey, D, Rubin, H, Bode, W. | | Deposit date: | 2000-09-03 | | Release date: | 2001-01-31 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Crystal structure of the caspase activator human granzyme B, a proteinase highly specific for an Asp-P1 residue.
Biol.Chem., 381, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
6QF7
 | | Crystal structures of the recombinant beta-Factor XIIa protease with bound Thr-Arg and Pro-Arg substrate mimetics | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Coagulation factor XII, ... | | Authors: | Pathak, M, Mannal, R, Li, C, Bubacarr, G.K, Badraldin, K.H, Belviso, B.D, Camila, R.B, Dreveny, I, Fischer, P.M, Dekker, L.V, Oliva, M.L.V, Emsley, J. | | Deposit date: | 2019-01-09 | | Release date: | 2019-06-05 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (4 Å) | | Cite: | Crystal structures of the recombinant beta-factor XIIa protease with bound Thr-Arg and Pro-Arg substrate mimetics.
Acta Crystallogr D Struct Biol, 75, 2019
|
|
4LK4
 | |
1GVZ
 | | Prostate Specific Antigen (PSA) from stallion seminal plasma | | Descriptor: | ACETATE ION, GLYCEROL, KALLIKREIN-1E2 | | Authors: | Carvalho, A.L, Sanz, L, Barettino, D, Romero, A, Calvete, J.J, Romao, M.J. | | Deposit date: | 2002-02-28 | | Release date: | 2002-09-12 | | Last modified: | 2011-09-21 | | Method: | X-RAY DIFFRACTION (1.42 Å) | | Cite: | Crystal Structure of a Prostate Kallikrein Isolated from Stallion Seminal Plasma: A Homologue of Human Psa
J.Mol.Biol., 322, 2002
|
|
4MCQ
 | |
