8QSI
 
 | |
4MSJ
 
 | Crystal structure of S. pombe AMSH-like protease SST2 catalytic domain from P212121 space group | Descriptor: | 1,2-ETHANEDIOL, AMSH-like protease sst2, GLYCINE, ... | Authors: | Shrestha, R.K, Ronau, J.A, Das, C. | Deposit date: | 2013-09-18 | Release date: | 2014-06-18 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Insights into the Mechanism of Deubiquitination by JAMM Deubiquitinases from Cocrystal Structures of the Enzyme with the Substrate and Product. Biochemistry, 53, 2014
|
|
7AJJ
 
 | bovine ATP synthase dimer state3:state3 | Descriptor: | 1,2-DIPALMITOYL-PHOSPHATIDYL-GLYCEROLE, ATP synthase F(0) complex subunit B1, mitochondrial, ... | Authors: | Spikes, T.E, Montgomery, M.G, Walker, J.E. | Deposit date: | 2020-09-29 | Release date: | 2021-02-03 | Last modified: | 2025-04-09 | Method: | ELECTRON MICROSCOPY (13.1 Å) | Cite: | Interface mobility between monomers in dimeric bovine ATP synthase participates in the ultrastructure of inner mitochondrial membranes. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
4MUF
 
 | |
4MV4
 
 | Crystal Structure of Biotin Carboxylase from Haemophilus influenzae in Complex with AMPPCP and Mg2 | Descriptor: | 1,2-ETHANEDIOL, Biotin carboxylase, CHLORIDE ION, ... | Authors: | Broussard, T.C, Pakhomova, S, Neau, D.B, Champion, T.S, Bonnot, R.J, Waldrop, G.L. | Deposit date: | 2013-09-23 | Release date: | 2015-01-14 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.61 Å) | Cite: | Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry, 54, 2015
|
|
3TYP
 
 | The crystal structure of the inorganic triphosphatase NE1496 | Descriptor: | 1,2-ETHANEDIOL, SODIUM ION, Uncharacterized protein | Authors: | Lunin, V.V, Skarina, T, Onopriyenko, O, Binkowski, T.A, Joachimiak, A, Edwards, A.M, Savchenko, A. | Deposit date: | 2011-09-26 | Release date: | 2012-05-09 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | A specific inorganic triphosphatase from Nitrosomonas europaea: structure and catalytic mechanism. J.Biol.Chem., 286, 2011
|
|
4MVS
 
 | Structural Basis for Ca2+ Selectivity of a Voltage-gated Calcium Channel | Descriptor: | 1,2-DIMYRISTOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CADMIUM ION, Ion transport protein | Authors: | Tang, L, Gamal El-Din, T.M, Payandeh, J, Martinez, G.Q, Heard, T.M, Scheuer, T, Zheng, N, Catterall, W.A. | Deposit date: | 2013-09-24 | Release date: | 2013-11-27 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.299 Å) | Cite: | Structural basis for Ca2+ selectivity of a voltage-gated calcium channel. Nature, 505, 2014
|
|
7AJH
 
 | bovine ATP synthase dimer state3:state1 | Descriptor: | 1,2-DIPALMITOYL-PHOSPHATIDYL-GLYCEROLE, ATP synthase F(0) complex subunit B1, mitochondrial, ... | Authors: | Spikes, T.E, Montgomery, M.G, Walker, J.E. | Deposit date: | 2020-09-29 | Release date: | 2021-02-03 | Last modified: | 2025-04-09 | Method: | ELECTRON MICROSCOPY (9.7 Å) | Cite: | Interface mobility between monomers in dimeric bovine ATP synthase participates in the ultrastructure of inner mitochondrial membranes. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
5FU8
 
 | Pseudomonas aeruginosa RmlA in complex with allosteric inhibitor | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CHLORIDE ION, GLUCOSE-1-PHOSPHATE THYMIDYLYLTRANSFERASE, ... | Authors: | Alphey, M.S, Tran, F, Westwood, N.J, Naismith, J.H. | Deposit date: | 2016-01-21 | Release date: | 2017-02-22 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Allosteric Competitive Inhibitors of the Glucose-1-Phosphate Thymidylyltransferase (Rmla) from Pseudomonas Aeruginosa. To be Published
|
|
7B33
 
 | MST3 in complex with MRIA11 | Descriptor: | 1,2-ETHANEDIOL, 8-[(5-azanyl-1,3-dioxan-2-yl)methyl]-6-[4-[6-[bis(fluoranyl)methyl]pyridin-2-yl]-2-chloranyl-phenyl]-2-(methylamino)pyrido[2,3-d]pyrimidin-7-one, Serine/threonine-protein kinase 24 | Authors: | Tesch, R, Rak, M, Joerger, A.C, Knapp, S, Structural Genomics Consortium (SGC) | Deposit date: | 2020-11-28 | Release date: | 2020-12-16 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structure-Based Design of Selective Salt-Inducible Kinase Inhibitors. J.Med.Chem., 64, 2021
|
|
3HFP
 
 | |
7AJD
 
 | bovine ATP synthase dimer state1:state3 | Descriptor: | 1,2-DIPALMITOYL-PHOSPHATIDYL-GLYCEROLE, ATP synthase F(0) complex subunit B1, mitochondrial, ... | Authors: | Spikes, T.E, Montgomery, M.G, Walker, J.E. | Deposit date: | 2020-09-29 | Release date: | 2021-02-03 | Last modified: | 2025-04-09 | Method: | ELECTRON MICROSCOPY (9 Å) | Cite: | Interface mobility between monomers in dimeric bovine ATP synthase participates in the ultrastructure of inner mitochondrial membranes. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
8QM5
 
 | Potential drug binding sites for translation initiation factor eIF4E | Descriptor: | 1-(4-chlorophenyl)cyclopentane-1-carboxylic acid, Eukaryotic translation initiation factor 4E, TRIETHYLENE GLYCOL | Authors: | Cleasby, A. | Deposit date: | 2023-09-21 | Release date: | 2025-01-15 | Last modified: | 2025-03-12 | Method: | X-RAY DIFFRACTION (1.889 Å) | Cite: | Integrating fragment-based screening with targeted protein degradation and genetic rescue to explore eIF4E function. Nat Commun, 15, 2024
|
|
7AJC
 
 | bovine ATP synthase dimer state1:state2 | Descriptor: | 1,2-DIPALMITOYL-PHOSPHATIDYL-GLYCEROLE, ATP synthase F(0) complex subunit B1, mitochondrial, ... | Authors: | Spikes, T.E, Montgomery, M.G, Walker, J.E. | Deposit date: | 2020-09-29 | Release date: | 2021-02-03 | Last modified: | 2025-04-09 | Method: | ELECTRON MICROSCOPY (11.9 Å) | Cite: | Interface mobility between monomers in dimeric bovine ATP synthase participates in the ultrastructure of inner mitochondrial membranes. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
4N3R
 
 | Co-crystal structure of tankyrase 1 with compound 2 (5-(2-aminoquinazolin-6-yl)-N-(4,4-dimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-7-yl)-2-fluorobenzamide) | Descriptor: | 5-(2-aminoquinazolin-6-yl)-N-(4,4-dimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-7-yl)-2-fluorobenzamide, Tankyrase-1, ZINC ION | Authors: | Huang, X. | Deposit date: | 2013-10-07 | Release date: | 2013-12-11 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structure-based design of 2-aminopyridine oxazolidinones as potent and selective tankyrase inhibitors. ACS Med Chem Lett, 4, 2013
|
|
5FYE
 
 | Pseudomonas aeruginosa RmlA in complex with allosteric inhibitor | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CHLORIDE ION, GLUCOSE-1-PHOSPHATE THYMIDYLYLTRANSFERASE, ... | Authors: | Alphey, M.S, Tran, F, Westwood, N.J, Naismith, J.H. | Deposit date: | 2016-03-07 | Release date: | 2017-03-22 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Allosteric Competitive Inhibitors of the Glucose-1-Phosphate Thymidylyltransferase (Rmla) from Pseudomonas Aeruginosa. To be Published
|
|
3TIY
 
 | CDK2 in complex with NSC 35676 | Descriptor: | 1,2-ETHANEDIOL, 2,3,4,6-tetrahydroxy-5H-benzo[7]annulen-5-one, Cyclin-dependent kinase 2 | Authors: | Alam, R, Schonbrunn, E. | Deposit date: | 2011-08-22 | Release date: | 2012-08-22 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.84 Å) | Cite: | A Novel Approach to the Discovery of Small-Molecule Ligands of CDK2. Chembiochem, 13, 2012
|
|
7AI0
 
 | |
4MSM
 
 | Crystal structure of Schizosaccharomyces pombe AMSH-like protease sst2 E286A mutant bound to ubiquitin | Descriptor: | 1,2-ETHANEDIOL, AMSH-like protease sst2, PHOSPHATE ION, ... | Authors: | Shrestha, R.K, Ronau, J.A, Das, C. | Deposit date: | 2013-09-18 | Release date: | 2014-06-18 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.74 Å) | Cite: | Insights into the Mechanism of Deubiquitination by JAMM Deubiquitinases from Cocrystal Structures of the Enzyme with the Substrate and Product. Biochemistry, 53, 2014
|
|
1KWR
 
 | HUMAN CARBONIC ANHYDRASE II COMPLEXED WITH INHIBITOR 0134-36 | Descriptor: | 1-METHYL-3-OXO-1,3-DIHYDRO-BENZO[C]ISOTHIAZOLE-5-SULFONIC ACID AMIDE, Carbonic anhydrase II, ZINC ION | Authors: | Grueneberg, S, Stubbs, M.T. | Deposit date: | 2002-01-30 | Release date: | 2003-01-07 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Successful virtual screening for novel inhibitors of human carbonic anhydrase: strategy and experimental confirmation. J.Med.Chem., 45, 2002
|
|
1KX4
 
 | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KTP
 
 | |
4MVR
 
 | Structural Basis for Ca2+ Selectivity of a Voltage-gated Calcium Channel | Descriptor: | 1,2-DIMYRISTOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, Ion transport protein, MANGANESE (II) ION | Authors: | Tang, L, Gamal El-Din, T.M, Payandeh, J, Gilbert, Q.M, Heard, T.M, Scheuer, T, Zheng, N, Catterall, W.A. | Deposit date: | 2013-09-24 | Release date: | 2013-11-27 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.196 Å) | Cite: | Structural basis for Ca2+ selectivity of a voltage-gated calcium channel. Nature, 505, 2014
|
|
4MW3
 
 | Structural Basis for Ca2+ Selectivity of a Voltage-gated Calcium Channel | Descriptor: | 1,2-DIMYRISTOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CALCIUM ION, Ion transport protein | Authors: | Tang, L, Gamal El-Din, T.M, Payandeh, J, Martinez, G.Q, Heard, T.M, Scheuer, T, Zheng, N, Catterall, W.A. | Deposit date: | 2013-09-24 | Release date: | 2013-11-27 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.2997 Å) | Cite: | Structural basis for Ca2+ selectivity of a voltage-gated calcium channel. Nature, 505, 2014
|
|
6TCU
 
 | Glycogen synthase kinase-3 beta (GSK3b) in complex with ligand 1 | Descriptor: | 5-[2,3-bis(fluoranyl)phenyl]-~{N}-[[1-(2-methoxyethyl)piperidin-4-yl]methyl]-1~{H}-indazole-3-carboxamide, ACETATE ION, Glycogen synthase kinase-3 beta | Authors: | Lammens, A, Krapp, S, Buonfiglio, R, Ombrato, R. | Deposit date: | 2019-11-06 | Release date: | 2020-09-16 | Last modified: | 2024-10-23 | Method: | X-RAY DIFFRACTION (2.14 Å) | Cite: | Optimization of Indazole-Based GSK-3 Inhibitors with Mitigated hERG Issue andIn VivoActivity in a Mood Disorder Model. Acs Med.Chem.Lett., 11, 2020
|
|