6O1D
 
 | |
6O22
 | | Structure of Asf1-H3:H4-Rtt109-Vps75 histone chaperone-lysine acetyltransferase complex with the histone substrate. | | Descriptor: | Histone H3.2, Histone H4, Histone acetyltransferase RTT109, ... | | Authors: | Danilenko, N, Carlomagno, T, Kirkpatrick, J.P. | | Deposit date: | 2019-02-22 | | Release date: | 2019-07-31 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR, SOLUTION SCATTERING | | Cite: | Histone chaperone exploits intrinsic disorder to switch acetylation specificity.
Nat Commun, 10, 2019
|
|
1M18
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
1M19
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1N1J
 | | Crystal structure of the NF-YB/NF-YC histone pair | | Descriptor: | NF-YB, NF-YC | | Authors: | Romier, C, Cocchiarella, F, Mantovani, R, Moras, D. | | Deposit date: | 2002-10-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.67 Å) | | Cite: | The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y
J.Biol.Chem., 278, 2003
|
|
1M1A
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.MOL.BIOL., 326, 2003
|
|
3MGS
 | |
3NQU
 | |
3MGQ
 | | Binding of Nickel ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
3MVD
 | | Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particle | | Descriptor: | DNA (146-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Makde, R.D, England, J.R, Yennawar, H.P, Tan, S. | | Deposit date: | 2010-05-04 | | Release date: | 2010-08-25 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structure of RCC1 chromatin factor bound to the nucleosome core particle.
Nature, 467, 2010
|
|
3MNN
 | | A Ruthenium Antitumour Agent Forms Specific Histone Protein Adducts in the Nucleosome Core | | Descriptor: | 1,3,5-triaza-7-phosphatricyclo[3.3.1.1~3,7~]decane, 1-methyl-4-(1-methylethyl)benzene, DNA (145-MER), ... | | Authors: | Ong, M.S, Davey, C.A. | | Deposit date: | 2010-04-22 | | Release date: | 2011-04-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | A ruthenium antimetastasis agent forms specific histone protein adducts in the nucleosome core
Chemistry, 17, 2011
|
|
3MGP
 | | Binding of Cobalt ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, COBALT (II) ION, DNA (147-MER), ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.44 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
3NQJ
 | | Crystal structure of (CENP-A/H4)2 heterotetramer | | Descriptor: | Histone H3-like centromeric protein A, Histone H4, PHOSPHATE ION | | Authors: | Sekulic, N, Black, B.E. | | Deposit date: | 2010-06-29 | | Release date: | 2010-08-25 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The structure of (CENP-A-H4)(2) reveals physical features that mark centromeres.
Nature, 467, 2010
|
|
3O62
 | |
8B0A
 | | Cryo-EM structure of ALC1 bound to an asymmetric, site-specifically PARylated nucleosome | | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (149-MER) Widom 601 sequence, Histone H2A type 1, ... | | Authors: | Bacic, L, Gaullier, G, Deindl, S. | | Deposit date: | 2022-09-07 | | Release date: | 2023-09-20 | | Last modified: | 2024-04-03 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Asymmetric nucleosome PARylation at DNA breaks mediates directional nucleosome sliding by ALC1.
Nat Commun, 15, 2024
|
|
8CEO
 | |
8BZ1
 | | RNA polymerase II core pre-initiation complex with the proximal +1 nucleosome (cPIC-Nuc10W) | | Descriptor: | DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, DNA-directed RNA polymerase II subunit RPB11-a, ... | | Authors: | Abril-Garrido, J, Dienemann, C, Grabbe, F, Velychko, T, Lidschreiber, M, Wang, H, Cramer, P. | | Deposit date: | 2022-12-14 | | Release date: | 2023-05-03 | | Last modified: | 2023-06-14 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Structural basis of transcription reduction by a promoter-proximal +1 nucleosome.
Mol.Cell, 83, 2023
|
|
8COM
 | | Structure of the Nucleosome Core Particle from Trypanosoma brucei | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Burdett, H, Deak, G, Wilson, M.D. | | Deposit date: | 2023-02-28 | | Release date: | 2023-07-12 | | Last modified: | 2023-09-06 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Histone divergence in trypanosomes results in unique alterations to nucleosome structure.
Nucleic Acids Res., 51, 2023
|
|
8CBQ
 | | structure of LEDGF/p75 PWWP domain bound to the H3K36 trimethylated dinucleosome | | Descriptor: | Histone H2A, Histone H2B 1.1, Histone H3, ... | | Authors: | Koutna, E, Kouba, T, Novacek, J, Veverka, V. | | Deposit date: | 2023-01-25 | | Release date: | 2023-09-06 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (4 Å) | | Cite: | Multivalency of nucleosome recognition by LEDGF.
Nucleic Acids Res., 51, 2023
|
|
8CBN
 | | structure of LEDGF/p75 PWWP domain bound to the H3K36 trimethylated dinucleosome | | Descriptor: | Histone H2A, Histone H2B 1.1, Histone H3, ... | | Authors: | Koutna, E, Kouba, T, Novacek, J, Veverka, V. | | Deposit date: | 2023-01-25 | | Release date: | 2023-12-27 | | Method: | ELECTRON MICROSCOPY (3.34 Å) | | Cite: | Multivalency of nucleosome recognition by LEDGF.
Nucleic Acids Res., 51, 2023
|
|
8DK5
 | | Structure of 187bp LIN28b nucleosome with site 0 mutation | | Descriptor: | DNA (187-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Lian, T, Guan, R, Bai, Y. | | Deposit date: | 2022-07-02 | | Release date: | 2023-06-28 | | Method: | ELECTRON MICROSCOPY (2.71 Å) | | Cite: | Structural mechanism of LIN28B nucleosome targeting by OCT4.
Mol.Cell, 83, 2023
|
|
6O96
 | | Dot1L bound to the H2BK120 Ubiquitinated nucleosome | | Descriptor: | DNA (146-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Valencia-Sanchez, M.I, De Ioannes, P.E, Miao, W, Vasilyev, N, Chen, R, Nudler, E, Armache, J.-P, Armache, K.-J. | | Deposit date: | 2019-03-13 | | Release date: | 2019-04-24 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structural Basis of Dot1L Stimulation by Histone H2B Lysine 120 Ubiquitination.
Mol.Cell, 74, 2019
|
|
