8CXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxs by Molmil](/molmil-images/mine/8cxs) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Inhibitor MTA | Descriptor: | 1,2-ETHANEDIOL, 5'-DEOXY-5'-METHYLTHIOADENOSINE, DNA Strand 1, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.49 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CXT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxt by Molmil](/molmil-images/mine/8cxt) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Inhibitor N6-benzyladenosine (Compound 1) | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.61 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CXV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxv by Molmil](/molmil-images/mine/8cxv) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Compound 3 | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.26 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CXY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxy by Molmil](/molmil-images/mine/8cxy) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Inhibitor N6-(2-Phenethyl)adenosine (Compound 8) | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.19 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CXW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxw by Molmil](/molmil-images/mine/8cxw) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Inhibitor piclidenoson (Compound 4) | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.78 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CXU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cxu by Molmil](/molmil-images/mine/8cxu) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Compound 2 | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.28 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8CY2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8cy2 by Molmil](/molmil-images/mine/8cy2) | CamA Adenine Methyltransferase Complexed to Cognate Substrate DNA and Inhibitor APNEA (Compound 9) | Descriptor: | 1,2-ETHANEDIOL, DNA Strand 1, DNA Strand 2, ... | Authors: | Horton, J.R, Zhou, J, Cheng, X. | Deposit date: | 2022-05-22 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.81 Å) | Cite: | Systematic Design of Adenosine Analogs as Inhibitors of a Clostridioides difficile- Specific DNA Adenine Methyltransferase Required for Normal Sporulation and Persistence. J.Med.Chem., 66, 2023
|
|
8FIM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8fim by Molmil](/molmil-images/mine/8fim) | Structure of APOBEC3A (E72A inactive mutant) in complex with TTC-hairpin DNA substrate | Descriptor: | CHLORIDE ION, DNA (5'-D(*TP*GP*CP*GP*CP*TP*TP*CP*GP*CP*GP*CP*T)-3'), DNA dC->dU-editing enzyme APOBEC-3A, ... | Authors: | Harjes, S, Jameson, G.B, Harjes, E, Filichev, V.V, Kurup, H.M. | Deposit date: | 2022-12-16 | Release date: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.22 Å) | Cite: | DNA-based inhibitors restrict mutagenic activity of APOBEC3 in cells To Be Published
|
|
5GKF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5gkf by Molmil](/molmil-images/mine/5gkf) | Structure of EndoMS-dsDNA1' complex | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, DNA (5'-D(*CP*GP*CP*TP*AP*CP*AP*TP*GP*TP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*GP*GP*AP*CP*GP*AP*CP*TP*TP*GP*TP*AP*GP*CP*G)-3'), ... | Authors: | Nakae, S, Hijikata, A, Tsuji, T, Yonezawa, K, Kouyama, K, Mayanagi, K, Ishino, S, Ishino, Y, Shirai, T. | Deposit date: | 2016-07-04 | Release date: | 2016-11-02 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease Structure, 24, 2016
|
|
8J9V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8j9v by Molmil](/molmil-images/mine/8j9v) | Cryo-EM structure of the African swine fever virus topoisomerase 2 complexed with Cut02aDNA and etoposide (EDI-1) | Descriptor: | (5S,5aR,8aR,9R)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5,5a,6,8,8a,9-hexahydrofuro[3',4':6,7]naphtho[2,3-d][1,3]dioxol -5-yl 4,6-O-[(1R)-ethylidene]-beta-D-glucopyranoside, DNA (5'-D(*GP*AP*GP*GP*TP*AP*TP*GP*TP*AP*GP*GP*C)-3'), DNA (5'-D(*GP*GP*CP*CP*GP*CP*CP*TP*AP*CP*AP*TP*AP*CP*CP*TP*C)-3'), ... | Authors: | Chang, C.-W, Tsai, M.-D. | Deposit date: | 2023-05-05 | Release date: | 2024-02-07 | Last modified: | 2024-04-17 | Method: | ELECTRON MICROSCOPY (2.71 Å) | Cite: | A unified view on enzyme catalysis by cryo-EM study of a DNA topoisomerase. Commun Chem, 7, 2024
|
|
8J9W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8j9w by Molmil](/molmil-images/mine/8j9w) | Cryo-EM structure of the African swine fever virus topoisomerase 2 complexed with Cut02bDNA and etoposide (EDI-2) | Descriptor: | (5S,5aR,8aR,9R)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5,5a,6,8,8a,9-hexahydrofuro[3',4':6,7]naphtho[2,3-d][1,3]dioxol -5-yl 4,6-O-[(1R)-ethylidene]-beta-D-glucopyranoside, DNA (5'-D(*AP*AP*GP*AP*AP*CP*TP*CP*TP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*AP*TP*GP*CP*TP*AP*CP*AP*GP*AP*GP*TP*TP*CP*TP*T)-3'), ... | Authors: | Chang, C.-W, Tsai, M.-D. | Deposit date: | 2023-05-05 | Release date: | 2024-02-07 | Last modified: | 2024-04-17 | Method: | ELECTRON MICROSCOPY (2.76 Å) | Cite: | A unified view on enzyme catalysis by cryo-EM study of a DNA topoisomerase. Commun Chem, 7, 2024
|
|
8JKK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8jkk by Molmil](/molmil-images/mine/8jkk) | |
5GKE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5gke by Molmil](/molmil-images/mine/5gke) | Structure of EndoMS-dsDNA1 complex | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, DNA (5'-D(*CP*GP*CP*TP*AP*CP*AP*TP*GP*TP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*GP*GP*AP*CP*GP*AP*CP*GP*TP*GP*TP*AP*GP*CP*G)-3'), ... | Authors: | Nakae, S, Hijikata, A, Tsuji, T, Yonezawa, K, Kouyama, K, Mayanagi, K, Ishino, S, Ishino, Y, Shirai, T. | Deposit date: | 2016-07-04 | Release date: | 2016-11-02 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease Structure, 24, 2016
|
|
5GKH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5gkh by Molmil](/molmil-images/mine/5gkh) | Structure of EndoMS-dsDNA2 complex | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, DNA (5'-D(*AP*CP*GP*GP*CP*AP*CP*TP*TP*GP*GP*CP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*TP*GP*CP*CP*AP*GP*GP*TP*GP*CP*CP*GP*T)-3'), ... | Authors: | Nakae, S, Hijikata, A, Tsuji, T, Yonezawa, K, Kouyama, K, Mayanagi, K, Ishino, S, Ishino, Y, Shirai, T. | Deposit date: | 2016-07-04 | Release date: | 2016-11-02 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease Structure, 24, 2016
|
|
6T8G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6t8g by Molmil](/molmil-images/mine/6t8g) | Stalled FtsK motor domain bound to dsDNA | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA translocase FtsK, dsDNA substrate | Authors: | Jean, N.L, Lowe, J. | Deposit date: | 2019-10-24 | Release date: | 2019-11-20 | Last modified: | 2024-05-22 | Method: | ELECTRON MICROSCOPY (4.34 Å) | Cite: | FtsK in motion reveals its mechanism for double-stranded DNA translocation. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
4ZCF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4zcf by Molmil](/molmil-images/mine/4zcf) | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|
8OEJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oej by Molmil](/molmil-images/mine/8oej) | Extended RPA-DNA nucleoprotein filament | Descriptor: | RPA14 subunit of the hetero-oligomeric complex involved in homologous recombination, RPA32 subunit of the hetero-oligomeric complex involved in homologous recombination, Replication factor A, ... | Authors: | Madru, C, Martinez-Carranza, M, Sauguet, L. | Deposit date: | 2023-03-10 | Release date: | 2023-05-10 | Last modified: | 2024-07-24 | Method: | ELECTRON MICROSCOPY (7.96 Å) | Cite: | DNA-binding mechanism and evolution of replication protein A. Nat Commun, 14, 2023
|
|
8OEL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oel by Molmil](/molmil-images/mine/8oel) | Condensed RPA-DNA nucleoprotein filament | Descriptor: | RPA14 subunit of the hetero-oligomeric complex involved in homologous recombination, RPA32 subunit of the hetero-oligomeric complex involved in homologous recombination, Replication factor A, ... | Authors: | Madru, C, Martinez-Carranza, M, Sauguet, L. | Deposit date: | 2023-03-10 | Release date: | 2023-06-14 | Last modified: | 2024-07-24 | Method: | ELECTRON MICROSCOPY (8.24 Å) | Cite: | DNA-binding mechanism and evolution of replication protein A. Nat Commun, 14, 2023
|
|
7OMY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7omy by Molmil](/molmil-images/mine/7omy) | Thermus sp. 2.9 DarT in complex with carba-NAD+ and ssDNA | Descriptor: | CARBA-NICOTINAMIDE-ADENINE-DINUCLEOTIDE, DNA (5'-D(*AP*TP*GP*TP*C)-3'), DarT domain-containing protein, ... | Authors: | Schuller, M, Ariza, A. | Deposit date: | 2021-05-24 | Release date: | 2021-06-23 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Molecular basis for DarT ADP-ribosylation of a DNA base. Nature, 596, 2021
|
|
6T66
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6t66 by Molmil](/molmil-images/mine/6t66) | Crystal structure of the Vibrio cholerae replicative helicase (DnaB) with GDP-AlF4 | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, Replicative DNA helicase, ... | Authors: | Legrand, P, Quevillon-Cheruel, S, Li de la Sierra-Gallay, I, Walbott, H. | Deposit date: | 2019-10-17 | Release date: | 2021-04-28 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3.9 Å) | Cite: | Study of the DnaB:DciA interplay reveals insights into the primary mode of loading of the bacterial replicative helicase. Nucleic Acids Res., 49, 2021
|
|
6T8O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6t8o by Molmil](/molmil-images/mine/6t8o) | Stalled FtsK motor domain bound to dsDNA end | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA translocase FtsK, dsDNA substrate | Authors: | Jean, N.L, Lowe, J. | Deposit date: | 2019-10-24 | Release date: | 2019-11-20 | Last modified: | 2024-05-22 | Method: | ELECTRON MICROSCOPY (3.99 Å) | Cite: | FtsK in motion reveals its mechanism for double-stranded DNA translocation. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
5ZLC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5zlc by Molmil](/molmil-images/mine/5zlc) | Binary complex of human DNA Polymerase Mu with MndGTP | Descriptor: | 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, DNA-directed DNA/RNA polymerase mu, MANGANESE (II) ION, ... | Authors: | Chang, Y.K, Wu, W.J, Tsai, M.D. | Deposit date: | 2018-03-27 | Release date: | 2019-05-29 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Human DNA Polymerase mu Can Use a Noncanonical Mechanism for Multiple Mn2+-Mediated Functions. J.Am.Chem.Soc., 141, 2019
|
|
1XHZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1xhz by Molmil](/molmil-images/mine/1xhz) | Phi29 DNA polymerase, orthorhombic crystal form, ssDNA complex | Descriptor: | 5'-D(*TP*TP*TP*TP*T)-3', DNA polymerase | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | Deposit date: | 2004-09-21 | Release date: | 2004-12-07 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Insights into Strand Displacement and Processivity from the Crystal Structure of the Protein-Primed DNA Polymerase of Bacteriophage phi29 Mol.Cell, 16, 2004
|
|
5LIT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5lit by Molmil](/molmil-images/mine/5lit) | Structure of the DNA duplex d(AAATTT)2 with the potential antiparasitic drug 6XV at 1.25 A resolution | Descriptor: | 4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1H-imidazol-2-yl)amino)phenyl)benzamide dihydrochloride, DNA (5'-D(*AP*AP*AP*TP*TP*T)-3'), MAGNESIUM ION | Authors: | Millan, C.R, Dardonville, C, de Koning, H.P, Saperas, N, Lourdes Campos, J. | Deposit date: | 2016-07-15 | Release date: | 2017-06-14 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.25 Å) | Cite: | Functional and structural analysis of AT-specific minor groove binders that disrupt DNA-protein interactions and cause disintegration of the Trypanosoma brucei kinetoplast. Nucleic Acids Res., 45, 2017
|
|
8YHA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8yha by Molmil](/molmil-images/mine/8yha) | Type I-EHNH Cascade-ssDNA complex | Descriptor: | 61-nt crRNA, CRISPR system Cascade subunit CasC, CRISPR system Cascade subunit CasD, ... | Authors: | Li, Z. | Deposit date: | 2024-02-27 | Release date: | 2024-07-31 | Last modified: | 2024-08-07 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Mechanisms for HNH-mediated target DNA cleavage in type I CRISPR-Cas systems. Mol.Cell, 2024
|
|