6ELB
 
 | | Tryptophan Repressor TrpR from E.coli variant M42F T44L T81M N87G S88Y with Indole-3-acetic acid as ligand | | Descriptor: | 1H-INDOL-3-YLACETIC ACID, Trp operon repressor | | Authors: | Stiel, A.C, Shanmugaratnam, S, Herud-Sikimic, O, Juergens, G, Hocker, B. | | Deposit date: | 2017-09-28 | | Release date: | 2019-02-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.437 Å) | | Cite: | A biosensor for the direct visualization of auxin
Nature, 2021
|
|
6ELF
 | | Tryptophan Repressor TrpR from E.coli variant M42F T44L T81I S88Y with Indole-3-acetic acid as ligand | | Descriptor: | 1H-INDOL-3-YLACETIC ACID, Trp operon repressor | | Authors: | Stiel, A.C, Shanmugaratnam, S, Herud-Sikimic, O, Juergens, G, Hocker, B. | | Deposit date: | 2017-09-28 | | Release date: | 2019-02-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.832 Å) | | Cite: | A biosensor for the direct visualization of auxin
Nature, 2021
|
|
6ENN
 | | Tryptophan Repressor TrpR from E.coli variant T44L T81M N87G S88Y with Indole-3-acetic acid as ligand | | Descriptor: | 1H-INDOL-3-YLACETIC ACID, Trp operon repressor | | Authors: | Stiel, A.C, Shanmugaratnam, S, Herud-Sikimic, O, Juergens, G, Hocker, B. | | Deposit date: | 2017-10-05 | | Release date: | 2019-02-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.17 Å) | | Cite: | A biosensor for the direct visualization of auxin
Nature, 2021
|
|
7KCI
 | | DETERMINANTS OF REPRESSOR/OPERATOR RECOGNITION FROM THE STRUCTURE OF THE TRP OPERATOR BINDING SITE | | Descriptor: | Self-complementary deoxyoligonucleotide decamer d(CCACTAGTGG) | | Authors: | Shakked, Z, Guzikevich-Guerstein, G, Frolow, F, Rabinovich, D, Joachimiak, A, Sigler, P.B. | | Deposit date: | 1994-09-12 | | Release date: | 2020-10-14 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Determinants of repressor/operator recognition from the structure of the trp operator binding site.
Nature, 368, 1994
|
|
7JVT
 | |
6SY4
 | | TetR in complex with the TetR-binding RNA-aptamer K1 | | Descriptor: | TetR-binding aptamer K1 (43-MER), Tetracycline repressor protein class B from transposon Tn10 | | Authors: | Grau, F.C, Muller, Y.A, Suess, B, Groher, F, Jaeger, J. | | Deposit date: | 2019-09-27 | | Release date: | 2020-02-05 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.695 Å) | | Cite: | The complex formed between a synthetic RNA aptamer and the transcription repressor TetR is a structural and functional twin of the operator DNA-TetR regulator complex.
Nucleic Acids Res., 48, 2020
|
|
5JLU
 | |
5MWJ
 | | Structure Enabled Discovery of a Stapled Peptide Inhibitor to Target the Oncogenic Transcriptional Repressor TLE1 | | Descriptor: | DIMETHYL SULFOXIDE, Transducin-like enhancer protein 1, pepide inhibtor | | Authors: | McGrath, S, Tortorici, M, Vidler, L, Drouin, L, Westwood, I, Gimeson, P, Van Montfort, R, Hoelder, S. | | Deposit date: | 2017-01-18 | | Release date: | 2017-04-05 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.04 Å) | | Cite: | Structure-Enabled Discovery of a Stapled Peptide Inhibitor to Target the Oncogenic Transcriptional Repressor TLE1.
Chemistry, 23, 2017
|
|
3LHQ
 | | DNA-binding transcriptional repressor AcrR from Salmonella typhimurium. | | Descriptor: | 1,2-ETHANEDIOL, AcrAB operon repressor (TetR/AcrR family), DI(HYDROXYETHYL)ETHER | | Authors: | Osipiuk, J, Mulligan, R, Papazisi, L, Anderson, W.F, Joachimiak, A, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2010-01-22 | | Release date: | 2010-02-02 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.56 Å) | | Cite: | X-ray crystal structure of DNA-binding transcriptional repressor AcrR from Salmonella typhimurium.
To be Published
|
|
2P5L
 | | Crystal structure of a dimer of N-terminal domains of AhrC in complex with an 18bp DNA operator site | | Descriptor: | Arginine repressor, DNA (5'-D(*DCP*DAP*DTP*DGP*DAP*DAP*DTP*DAP*DAP*DAP*DAP*DAP*DTP*DTP*DCP*DAP*DAP*DG)-3'), DNA (5'-D(*DCP*DTP*DTP*DGP*DAP*DAP*DTP*DTP*DTP*DTP*DTP*DAP*DTP*DTP*DCP*DAP*DTP*DG)-3'), ... | | Authors: | Garnett, J.A, Marincs, F, Baumberg, S, Stockley, P.G, Phillips, S.E.V. | | Deposit date: | 2007-03-15 | | Release date: | 2008-03-11 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Structure and function of the arginine repressor-operator complex from Bacillus subtilis.
J.Mol.Biol., 379, 2008
|
|
1G3T
 | | CYS102SER DTXR | | Descriptor: | DIPHTHERIA TOXIN REPRESSOR | | Authors: | Pohl, E, Goranson-Siekierke, J, Holmes, R.K, Hol, W.G.J. | | Deposit date: | 2000-10-25 | | Release date: | 2001-10-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Structures of three diphtheria toxin repressor (DtxR) variants with decreased repressor activity.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1G3S
 | | CYS102SER DTXR | | Descriptor: | DIPHTHERIA TOXIN REPRESSOR | | Authors: | Pohl, E, Goranson-Siekierke, J, Holmes, R.K, Hol, W.G.J. | | Deposit date: | 2000-10-25 | | Release date: | 2001-10-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of three diphtheria toxin repressor (DtxR) variants with decreased repressor activity.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1G3Y
 | | ARG80ALA DTXR | | Descriptor: | DIPHTHERIA TOXIN REPRESSOR, ZINC ION | | Authors: | Pohl, E, Goranson-Siekierke, J, Holmes, R.K, Hol, W.G.J. | | Deposit date: | 2000-10-25 | | Release date: | 2001-10-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of three diphtheria toxin repressor (DtxR) variants with decreased repressor activity.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1G3W
 | | CD-CYS102SER DTXR | | Descriptor: | CADMIUM ION, DIPHTHERIA TOXIN REPRESSOR, SULFATE ION | | Authors: | Pohl, E, Goranson-Siekierke, J, Holmes, R.K, Hol, W.G.J. | | Deposit date: | 2000-10-25 | | Release date: | 2001-10-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of three diphtheria toxin repressor (DtxR) variants with decreased repressor activity.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
6FAL
 | |
6F7F
 | |
6F7G
 | |
6F9K
 | |
1WET
 | | STRUCTURE OF THE PURR-GUANINE-PURF OPERATOR COMPLEX | | Descriptor: | DNA (5'-D(*AP*AP*CP*GP*AP*AP*AP*AP*CP*GP*TP*TP*TP*TP*CP*GP*T )-3'), GUANINE, PROTEIN (PURINE REPRESSOR) | | Authors: | Schumacher, M.A, Glasfeld, A, Zalkin, H, Brennan, R.G. | | Deposit date: | 1997-04-27 | | Release date: | 1997-11-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The X-ray structure of the PurR-guanine-purF operator complex reveals the contributions of complementary electrostatic surfaces and a water-mediated hydrogen bond to corepressor specificity and binding affinity.
J.Biol.Chem., 272, 1997
|
|
2QQ9
 | | Crystal Structure of DtxR(D6A C102D) Complexed with Nickel(II) | | Descriptor: | Diphtheria toxin repressor, NICKEL (II) ION, PHOSPHATE ION | | Authors: | D'Aquino, J.A, Lattimer, J.R, Denninger, A, D'Aquino, K.E, Ringe, D. | | Deposit date: | 2007-07-26 | | Release date: | 2007-10-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.71 Å) | | Cite: | Role of the N-Terminal Helix in the Metal Ion-Induced Activation of the Diphtheria Toxin Repressor DtxR.
Biochemistry, 46, 2007
|
|
2QQB
 | | Crystal Structure of DtxR(M10A C102D) Complexed with Nickel(II) | | Descriptor: | Diphtheria toxin repressor, NICKEL (II) ION, PHOSPHATE ION | | Authors: | D'Aquino, J.A, Lattimer, J.R, Denninger, A, D'Aquino, K.E, Ringe, D. | | Deposit date: | 2007-07-26 | | Release date: | 2007-10-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.92 Å) | | Cite: | Role of the N-Terminal Helix in the Metal Ion-Induced Activation of the Diphtheria Toxin Repressor DtxR.
Biochemistry, 46, 2007
|
|
6DKS
 | | Structure of the Rbpj-SHARP-DNA Repressor Complex | | Descriptor: | DNA (5'-D(*AP*AP*TP*CP*TP*TP*TP*CP*CP*CP*AP*CP*AP*GP*T)-3'), DNA (5'-D(*TP*TP*AP*CP*TP*GP*TP*GP*GP*GP*AP*AP*AP*GP*A)-3'), Maltose/maltodextrin-binding periplasmic protein, ... | | Authors: | Kovall, R.A, VanderWielen, B.D, Yuan, Z. | | Deposit date: | 2018-05-30 | | Release date: | 2019-01-02 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.78 Å) | | Cite: | Structural and Functional Studies of the RBPJ-SHARP Complex Reveal a Conserved Corepressor Binding Site.
Cell Rep, 26, 2019
|
|
2QQA
 | | Crystal Structure of DtxR(E9A C102D) Complexed with Nickel(II) | | Descriptor: | Diphtheria toxin repressor, NICKEL (II) ION, PHOSPHATE ION | | Authors: | D'Aquino, J.A, Lattimer, J.R, Denninger, A, D'Aquino, K.E, Ringe, D. | | Deposit date: | 2007-07-26 | | Release date: | 2007-10-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Role of the N-Terminal Helix in the Metal Ion-Induced Activation of the Diphtheria Toxin Repressor DtxR.
Biochemistry, 46, 2007
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
1FWZ
 | | GLU20ALA DTXR | | Descriptor: | DIPHTHERIA TOXIN REPRESSOR, SULFATE ION, ZINC ION | | Authors: | Pohl, E, Goranson-Siekierke, J, Holmes, R.K, Hol, W.G.J. | | Deposit date: | 2000-09-25 | | Release date: | 2001-09-25 | | Last modified: | 2021-11-03 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structures of three diphtheria toxin repressor (DtxR) variants with decreased repressor activity.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
