1C94
| REVERSING THE SEQUENCE OF THE GCN4 LEUCINE ZIPPER DOES NOT AFFECT ITS FOLD. | Descriptor: | RETRO-GCN4 LEUCINE ZIPPER | Authors: | Mittl, P.R.E, Deillon, C.A, Sargent, D, Liu, N, Klauser, S, Thomas, R.M, Gutte, B, Gruetter, M.G. | Deposit date: | 1999-07-30 | Release date: | 2000-03-22 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.08 Å) | Cite: | The retro-GCN4 leucine zipper sequence forms a stable three-dimensional structure. Proc.Natl.Acad.Sci.USA, 97, 2000
|
|
1AOI
| COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | Authors: | Luger, K, Maeder, A.W, Richmond, R.K, Sargent, D.F, Richmond, T.J. | Deposit date: | 1997-07-03 | Release date: | 1998-09-30 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389, 1997
|
|
1ZBB
| Structure of the 4_601_167 Tetranucleosome | Descriptor: | DNA STRAND 1 (ARBITRARY MODEL SEQUENCE), DNA STRAND 2 (ARBITRARY MODEL SEQUENCE), HISTONE H3, ... | Authors: | Schalch, T, Duda, S, Sargent, D.F, Richmond, T.J. | Deposit date: | 2005-04-08 | Release date: | 2005-07-12 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (9 Å) | Cite: | X-ray structure of a tetranucleosome and its implications for the chromatin fibre. Nature, 436, 2005
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
2Y9Z
| Chromatin Remodeling Factor ISW1a(del_ATPase) in DNA complex | Descriptor: | I-DNA/E-DNA, IMITATION SWITCH PROTEIN 1 (DEL_ATPASE), ISWI ONE COMPLEX PROTEIN 3 | Authors: | Yamada, K, Frouws, T.D, Angst, B, Fitzgerald, D.J, DeLuca, C, Schimmele, K, Sargent, D.F, Richmond, T.J. | Deposit date: | 2011-02-17 | Release date: | 2011-04-20 | Last modified: | 2012-03-28 | Method: | X-RAY DIFFRACTION (3.601 Å) | Cite: | Structure and Mechanism of the Chromatin Remodelling Factor Isw1A Nature, 472, 2011
|
|
1KSO
| CRYSTAL STRUCTURE OF APO S100A3 | Descriptor: | S100 CALCIUM-BINDING PROTEIN A3 | Authors: | Mittl, P.R, Fritz, G, Sargent, D.F, Richmond, T.J, Heizmann, C.W, Grutter, M.G. | Deposit date: | 2002-01-14 | Release date: | 2002-07-31 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Metal-free MIRAS phasing: structure of apo-S100A3. Acta Crystallogr.,Sect.D, 58, 2002
|
|
2Y9Y
| Chromatin Remodeling Factor ISW1a(del_ATPase) | Descriptor: | IMITATION SWITCH PROTEIN 1 (DEL_ATPASE), ISWI ONE COMPLEX PROTEIN 3 | Authors: | Yamada, K, Frouws, T.D, Angst, B, Fitzgerald, D.J, DeLuca, C, Schimmele, K, Sargent, D.F, Richmond, T.J. | Deposit date: | 2011-02-17 | Release date: | 2011-04-20 | Last modified: | 2012-03-28 | Method: | X-RAY DIFFRACTION (3.25 Å) | Cite: | Structure and Mechanism of the Chromatin Remodelling Factor Isw1A. Nature, 472, 2011
|
|
1M41
| Crystal structure of Escherichia coli alkanesulfonate monooxygenase SsuD at 2.3 A resolution | Descriptor: | FMNH2-dependent alkanesulfonate monooxygenase | Authors: | Eichhorn, E, Davey, C.A, Sargent, D.F, Leisinger, T, Richmond, T.J. | Deposit date: | 2002-07-02 | Release date: | 2002-12-11 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal Structure of Escherichia coli Alkanesulfonate Monooxygenase SsuD J.mol.biol., 324, 2002
|
|
1YTF
| YEAST TFIIA/TBP/DNA COMPLEX | Descriptor: | DNA (5'-D(*GP*TP*TP*TP*TP*AP*TP*AP*TP*AP*CP*AP*TP*AP*CP*A)-3'), DNA (5'-D(*TP*GP*TP*AP*TP*GP*TP*AP*TP*AP*TP*AP*AP*AP*AP*C)-3'), PROTEIN (TATA BINDING PROTEIN (TBP)), ... | Authors: | Tan, S, Hunziker, Y, Sargent, D.F, Richmond, T.J. | Deposit date: | 1996-04-05 | Release date: | 1996-06-20 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structure of a yeast TFIIA/TBP/DNA complex. Nature, 381, 1996
|
|
1JFU
| CRYSTAL STRUCTURE OF THE SOLUBLE DOMAIN OF TLPA FROM BRADYRHIZOBIUM JAPONICUM | Descriptor: | THIOL:DISULFIDE INTERCHANGE PROTEIN TLPA | Authors: | Capitani, G, Rossmann, R, Sargent, D.F, Gruetter, M.G, Richmond, T.J, Hennecke, H. | Deposit date: | 2001-06-22 | Release date: | 2001-09-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure of the soluble domain of a membrane-anchored thioredoxin-like protein from Bradyrhizobium japonicum reveals unusual properties. J.Mol.Biol., 311, 2001
|
|