7ZGO
 
 | | Cryo-EM structure of human NKCC1 (TM domain) | | Descriptor: | (2S)-3-(hexadecanoyloxy)-2-[(9Z)-octadec-9-enoyloxy]propyl 2-(trimethylammonio)ethyl phosphate, CHLORIDE ION, CHOLESTEROL HEMISUCCINATE, ... | | Authors: | Nissen, P, Fenton, R, Neumann, C, Lindtoft Rosenbaek, L, Kock Flygaard, R, Habeck, M, Lykkegaard Karlsen, J, Wang, Y, Lindorff-Larsen, K, Gad, H, Hartmann, R, Lyons, J. | | Deposit date: | 2022-04-04 | | Release date: | 2022-10-05 | | Last modified: | 2024-11-20 | | Method: | ELECTRON MICROSCOPY (2.55 Å) | | Cite: | Cryo-EM structure of the human NKCC1 transporter reveals mechanisms of ion coupling and specificity.
Embo J., 41, 2022
|
|
1B23
 | | E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex | | Descriptor: | CYSTEINE, CYSTEINYL TRNA, ELONGATION FACTOR TU, ... | | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Nyborg, J. | | Deposit date: | 1998-12-04 | | Release date: | 1998-12-07 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA.
Structure Fold.Des., 7, 1999
|
|
1TTT
 | | Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex | | Descriptor: | MAGNESIUM ION, OF ELONGATION FACTOR TU (EF-TU), PHENYLALANINE, ... | | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Polekhina, G, Reshetnikova, L, Clark, B.F.C, Nyborg, J. | | Deposit date: | 1995-11-16 | | Release date: | 1996-12-23 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog.
Science, 270, 1995
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
3DWU
 | |
6ZPL
 | | Inward-open structure of human glycine transporter 1 in complex with a benzoylisoindoline inhibitor, sybody Sb_GlyT1#7 and bound Na and Cl ions. | | Descriptor: | CHLORIDE ION, Endoglucanase H, SODIUM ION, ... | | Authors: | Shahsavar, A, Stohler, P, Bourenkov, G, Zimmermann, I, Siegrist, M, Guba, W, Pinard, E, Sinning, S, Seeger, M.A, Schneider, T.R, Dawson, R.J.P, Nissen, P. | | Deposit date: | 2020-07-08 | | Release date: | 2021-03-17 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (3.945 Å) | | Cite: | Structural insights into the inhibition of glycine reuptake.
Nature, 591, 2021
|
|
3F6K
 | | Crystal structure of the Vps10p domain of human sortilin/NTS3 in complex with neurotensin | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GLYCEROL, Neurotensin, ... | | Authors: | Quistgaard, E.M, Madsen, P, Groftehauge, M.K, Nissen, P, Petersen, C.M, Thirup, S. | | Deposit date: | 2008-11-06 | | Release date: | 2008-12-30 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Ligands bind to Sortilin in the tunnel of a ten-bladed beta-propeller domain.
Nat.Struct.Mol.Biol., 16, 2009
|
|
4NAB
 | | Structure of the (SR)Ca2+-ATPase mutant E309Q in the Ca2-E1-MgAMPPCP form | | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CALCIUM ION, POTASSIUM ION, ... | | Authors: | Bublitz, M, Clausen, J.D, Arnou, B, Montigny, C, Jaxel, C, Nissen, P, Moller, J.V, Andersen, J.P, le Maire, M. | | Deposit date: | 2013-10-22 | | Release date: | 2013-12-18 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | SERCA mutant E309Q binds two Ca(2+) ions but adopts a catalytically incompetent conformation.
Embo J., 32, 2013
|
|
3KDP
 | | Crystal structure of the sodium-potassium pump | | Descriptor: | CHOLESTEROL, MAGNESIUM ION, Na+/K+ ATPase gamma subunit transcript variant a, ... | | Authors: | Morth, J.P, Pedersen, B.P, Nissen, P. | | Deposit date: | 2009-10-23 | | Release date: | 2010-02-16 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Crystal structure of the sodium-potassium pump.
Nature, 450, 2007
|
|
7QTV
 | | Beryllium fluoride form of the Na+,K+-ATPase (E2-BeFx) | | Descriptor: | 1-O-decanoyl-beta-D-tagatofuranosyl beta-D-allopyranoside, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shahsavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | | Deposit date: | 2022-01-16 | | Release date: | 2022-11-23 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (4.05 Å) | | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state.
J.Biol.Chem., 298, 2022
|
|
4UU0
 | | CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF 14:1 PC | | Descriptor: | GLYCEROL, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | | Deposit date: | 2014-07-24 | | Release date: | 2014-10-01 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids.
FEBS J., 281, 2014
|
|
4US4
 | | Crystal Structure of the Bacterial NSS Member MhsT in an Occluded Inward-Facing State (lipidic cubic phase form) | | Descriptor: | (2R)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, (2S)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, SODIUM ION, ... | | Authors: | Malinauskaite, L, Quick, M, Reinhard, L, Lyons, J.A, Yano, H, Javitch, J.A, Nissen, P. | | Deposit date: | 2014-07-02 | | Release date: | 2014-09-24 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | A Mechanism for Intracellular Release of Na+ by Neurotransmitter/Sodium Symporters
Nat.Struct.Mol.Biol., 21, 2014
|
|
4UU1
 | | CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF DOPC | | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, GLYCEROL, MAGNESIUM ION, ... | | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | | Deposit date: | 2014-07-24 | | Release date: | 2014-10-01 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids.
FEBS J., 281, 2014
|
|
5I32
 | | Ammonia permeable aquaporin AtTIP2;1 | | Descriptor: | Aquaporin TIP2-1 | | Authors: | Kirscht, A, Nissen, P, Kjellbom, P, Gourdon, P, Johanson, U. | | Deposit date: | 2016-02-09 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.18 Å) | | Cite: | Crystal Structure of an Ammonia-Permeable Aquaporin.
Plos Biol., 14, 2016
|
|
8QMP
 | | Structure of the E2 Beryllium Fluoride Complex of the Autoinhibited Calcium ATPase ACA8 | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, Calcium-transporting ATPase 8, plasma membrane-type, ... | | Authors: | Thirup Larsen, S, Karlsen Dannersoe, J, Nissen, P. | | Deposit date: | 2023-09-25 | | Release date: | 2024-10-02 | | Last modified: | 2024-10-23 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Conserved N-terminal Regulation of the ACA8 Calcium Pump with Two Calmodulin Binding Sites.
J.Mol.Biol., 436, 2024
|
|
4UMV
 | | CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN THE E2P STATE | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, MAGNESIUM ION, ZINC-TRANSPORTING ATPASE | | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | | Deposit date: | 2014-05-21 | | Release date: | 2014-08-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
|
|
4UMW
 | | CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN E2.PI STATE | | Descriptor: | MAGNESIUM ION, TETRAFLUOROALUMINATE ION, ZINC-TRANSPORTING ATPASE | | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | | Deposit date: | 2014-05-21 | | Release date: | 2014-08-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.705 Å) | | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
|
|
6RB2
 | | Structure of the (SR)Ca2+-ATPase mutant E340A in the Ca2-E1-CaAMPPCP form | | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Clausen, J.D, Montigny, C, Lenoir, G, Arnou, B, Jaxel, C, Moller, J.V, Nissen, P, Andersen, J.P, Le Maire, M, Bublitz, M. | | Deposit date: | 2019-04-09 | | Release date: | 2020-05-06 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (3.20001125 Å) | | Cite: | The SERCA residue Glu340 mediates interdomain communication that guides Ca 2+ transport.
Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
3N8G
 | | Structure of the (SR)Ca2+-ATPase Ca2-E1-CaAMPPCP form | | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Bublitz, M, Olesen, C, Poulsen, H, Morth, J.P, Moller, J.V, Nissen, P. | | Deposit date: | 2010-05-28 | | Release date: | 2011-06-08 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.585 Å) | | Cite: | Ion pathways in the sarcoplasmic reticulum Ca2+-ATPase.
J.Biol.Chem., 288, 2013
|
|
5JAE
 | | LeuT in the outward-oriented, Na+-free return state, P21 form at pH 6.5 | | Descriptor: | Transporter, octyl beta-D-glucopyranoside | | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | | Deposit date: | 2016-04-12 | | Release date: | 2016-06-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
|
|
5JAG
 | | LeuT T354H mutant in the outward-oriented, Na+-free Return State | | Descriptor: | Transporter, octyl beta-D-glucopyranoside | | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | | Deposit date: | 2016-04-12 | | Release date: | 2016-06-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.58 Å) | | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1C04
 | | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | | Deposit date: | 1999-07-14 | | Release date: | 1999-08-31 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (5 Å) | | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
|
|
6HXB
 | | SERCA2a from pig heart | | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Sitsel, A, Andersen, J.L, Nissen, P, Olesen, C. | | Deposit date: | 2018-10-16 | | Release date: | 2019-02-27 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (4 Å) | | Cite: | Structures of the heart specific SERCA2a Ca 2+ -ATPase.
Embo J., 38, 2019
|
|
