7ZGO
 
 | | Cryo-EM structure of human NKCC1 (TM domain) | | Descriptor: | (2S)-3-(hexadecanoyloxy)-2-[(9Z)-octadec-9-enoyloxy]propyl 2-(trimethylammonio)ethyl phosphate, CHLORIDE ION, CHOLESTEROL HEMISUCCINATE, ... | | Authors: | Nissen, P, Fenton, R, Neumann, C, Lindtoft Rosenbaek, L, Kock Flygaard, R, Habeck, M, Lykkegaard Karlsen, J, Wang, Y, Lindorff-Larsen, K, Gad, H, Hartmann, R, Lyons, J. | | Deposit date: | 2022-04-04 | | Release date: | 2022-10-05 | | Last modified: | 2023-04-19 | | Method: | ELECTRON MICROSCOPY (2.55 Å) | | Cite: | Cryo-EM structure of the human NKCC1 transporter reveals mechanisms of ion coupling and specificity.
Embo J., 41, 2022
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1TTT
 | | Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex | | Descriptor: | MAGNESIUM ION, OF ELONGATION FACTOR TU (EF-TU), PHENYLALANINE, ... | | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Polekhina, G, Reshetnikova, L, Clark, B.F.C, Nyborg, J. | | Deposit date: | 1995-11-16 | | Release date: | 1996-12-23 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog.
Science, 270, 1995
|
|
1B23
 | | E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex | | Descriptor: | CYSTEINE, CYSTEINYL TRNA, ELONGATION FACTOR TU, ... | | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Nyborg, J. | | Deposit date: | 1998-12-04 | | Release date: | 1998-12-07 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA.
Structure Fold.Des., 7, 1999
|
|
3DWU
 | |
5I32
 | | Ammonia permeable aquaporin AtTIP2;1 | | Descriptor: | Aquaporin TIP2-1 | | Authors: | Kirscht, A, Nissen, P, Kjellbom, P, Gourdon, P, Johanson, U. | | Deposit date: | 2016-02-09 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.18 Å) | | Cite: | Crystal Structure of an Ammonia-Permeable Aquaporin.
Plos Biol., 14, 2016
|
|
1N0V
 | | Crystal structure of elongation factor 2 | | Descriptor: | Elongation factor 2 | | Authors: | Joergensen, R, Ortiz, P.A, Carr-Schmid, A, Nissen, P, Kinzy, T.G, Andersen, G.R. | | Deposit date: | 2002-10-15 | | Release date: | 2002-11-27 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Two crystal structures demonstrate large conformational changes in the eukaryotic ribosomal translocase.
Nat.Struct.Biol., 10, 2003
|
|
4H1W
 | | E1 structure of the (SR) Ca2+-ATPase in complex with Sarcolipin | | Descriptor: | MAGNESIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Bublitz, M, Winther, A.-M.L, Karlsen, J, Moller, J.V, Hansen, J.B, Buch-Pedersen, M.J, Nissen, P. | | Deposit date: | 2012-09-11 | | Release date: | 2013-03-06 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The sarcolipin-bound calcium pump stabilizes calcium sites exposed to the cytoplasm.
Nature, 495, 2013
|
|
6RB2
 | | Structure of the (SR)Ca2+-ATPase mutant E340A in the Ca2-E1-CaAMPPCP form | | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Clausen, J.D, Montigny, C, Lenoir, G, Arnou, B, Jaxel, C, Moller, J.V, Nissen, P, Andersen, J.P, Le Maire, M, Bublitz, M. | | Deposit date: | 2019-04-09 | | Release date: | 2020-05-06 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (3.20001125 Å) | | Cite: | The SERCA residue Glu340 mediates interdomain communication that guides Ca 2+ transport.
Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
9ERX
 | | Structural basis of D9-THC analog activity at the Cannabinoid 1 receptor | | Descriptor: | (6aR,10aR)-9-(hydroxymethyl)-6,6-dimethyl-3-(2-methyloctan-2-yl)-6a,7,10,10a-tetrahydrobenzo[c]chromen-1-ol, Antibody ScFv16 Fab fragment, Cannabinoid receptor 1, ... | | Authors: | Thorsen, T.S, Kulkarni, Y, Boggild, A, Drace, T, Nissen, P, Gajhede, M, Boesen, T, Kastrup, J.S, Gloriam, D. | | Deposit date: | 2024-03-25 | | Release date: | 2024-06-26 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Structural basis of Delta 9 -THC analog activity at the Cannabinoid 1 receptor.
Res Sq, 2024
|
|
7Z04
 | | 10 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | | Deposit date: | 2022-02-22 | | Release date: | 2022-11-23 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (7.5 Å) | | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state.
J.Biol.Chem., 298, 2022
|
|
7YZR
 | | 50 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | | Deposit date: | 2022-02-21 | | Release date: | 2022-11-23 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (6.92 Å) | | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state.
J.Biol.Chem., 298, 2022
|
|
4UU1
 | | CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF DOPC | | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, GLYCEROL, MAGNESIUM ION, ... | | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | | Deposit date: | 2014-07-24 | | Release date: | 2014-10-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids.
FEBS J., 281, 2014
|
|
4V69
 | | Ternary complex-bound E.coli 70S ribosome. | | Descriptor: | 16S rRNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Villa, E, Sengupta, J, Trabuco, L.G, LeBarron, J, Baxter, W.T, Shaikh, T.R, Grassucci, R.A, Nissen, P, Ehrenberg, M, Schulten, K, Frank, J. | | Deposit date: | 2008-12-11 | | Release date: | 2014-07-09 | | Last modified: | 2024-02-28 | | Method: | ELECTRON MICROSCOPY (6.7 Å) | | Cite: | Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis
Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
5A3Q
 | | Crystal structure of the (SR) Calcium ATPase E2-vanadate complex bound to thapsigargin and TNP-AMPPCP | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | | Authors: | Clausen, J.D, Bublitz, M, Arnou, B, Olesen, C, Andersen, J.P, Moller, J.V, Nissen, P. | | Deposit date: | 2015-06-02 | | Release date: | 2016-04-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.05 Å) | | Cite: | Crystal Structure of the Vanadate-Inhibited Ca(2+)-ATPase.
Structure, 24, 2016
|
|
5A3R
 | | Crystal structure of the (SR) Calcium ATPase E2.BeF3- complex bound to TNP-AMPPCP | | Descriptor: | MAGNESIUM ION, POTASSIUM ION, SARCOPLASMIC/ENDOPLASMIC RETICULUM CALCIUM ATPASE 1, ... | | Authors: | Clausen, J.D, Bublitz, M, Arnou, B, Olesen, C, Andersen, J.P, Moller, J.V, Nissen, P. | | Deposit date: | 2015-06-02 | | Release date: | 2016-04-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.05 Å) | | Cite: | Crystal Structure of the Vanadate-Inhibited Ca(2+)-ATPase.
Structure, 24, 2016
|
|
5A3S
 | | Crystal structure of the (SR) Calcium ATPase E2-vanadate complex bound to thapsigargin and TNP-ATP | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | | Authors: | Clausen, J.D, Bublitz, M, Arnou, B, Olesen, C, Andersen, J.P, Moller, J.V, Nissen, P. | | Deposit date: | 2015-06-03 | | Release date: | 2016-04-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Crystal Structure of the Vanadate-Inhibited Ca(2+)-ATPase.
Structure, 24, 2016
|
|
6ZPL
 | | Inward-open structure of human glycine transporter 1 in complex with a benzoylisoindoline inhibitor, sybody Sb_GlyT1#7 and bound Na and Cl ions. | | Descriptor: | CHLORIDE ION, Endoglucanase H, SODIUM ION, ... | | Authors: | Shahsavar, A, Stohler, P, Bourenkov, G, Zimmermann, I, Siegrist, M, Guba, W, Pinard, E, Sinning, S, Seeger, M.A, Schneider, T.R, Dawson, R.J.P, Nissen, P. | | Deposit date: | 2020-07-08 | | Release date: | 2021-03-17 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (3.945 Å) | | Cite: | Structural insights into the inhibition of glycine reuptake.
Nature, 591, 2021
|
|
4UMV
 | | CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN THE E2P STATE | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, MAGNESIUM ION, ZINC-TRANSPORTING ATPASE | | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | | Deposit date: | 2014-05-21 | | Release date: | 2014-08-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
|
|
4UMW
 | | CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN E2.PI STATE | | Descriptor: | MAGNESIUM ION, TETRAFLUOROALUMINATE ION, ZINC-TRANSPORTING ATPASE | | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | | Deposit date: | 2014-05-21 | | Release date: | 2014-08-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.705 Å) | | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
6HXB
 | | SERCA2a from pig heart | | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | | Authors: | Sitsel, A, Andersen, J.L, Nissen, P, Olesen, C. | | Deposit date: | 2018-10-16 | | Release date: | 2019-02-27 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (4 Å) | | Cite: | Structures of the heart specific SERCA2a Ca 2+ -ATPase.
Embo J., 38, 2019
|
|
5JAE
 | | LeuT in the outward-oriented, Na+-free return state, P21 form at pH 6.5 | | Descriptor: | Transporter, octyl beta-D-glucopyranoside | | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | | Deposit date: | 2016-04-12 | | Release date: | 2016-06-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
|
|
5JAG
 | | LeuT T354H mutant in the outward-oriented, Na+-free Return State | | Descriptor: | Transporter, octyl beta-D-glucopyranoside | | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | | Deposit date: | 2016-04-12 | | Release date: | 2016-06-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.58 Å) | | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
|
|
