1U35
 
 | | Crystal structure of the nucleosome core particle containing the histone domain of macroH2A | | Descriptor: | H2A histone family, Hist1h4i protein, Histone H3.1, ... | | Authors: | Chakravarthy, S, Gundimella, S.K, Caron, C, Perche, P.Y, Pehrson, J.R, Khochbin, S, Luger, K. | | Deposit date: | 2004-07-20 | | Release date: | 2005-09-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structural characterization of the histone variant macroH2A.
Mol.Cell.Biol., 25, 2005
|
|
3NFQ
 | |
1S32
 | | Molecular Recognition of the Nucleosomal 'Supergroove' | | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2004-01-12 | | Release date: | 2004-05-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove'
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1EYN
 | | Structure of mura liganded with the extrinsic fluorescence probe ANS | | Descriptor: | 8-ANILINO-1-NAPHTHALENE SULFONATE, GLYCEROL, UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE | | Authors: | Schonbrunn, E, Eschenburg, S, Luger, K, Kabsch, W, Amrhein, N. | | Deposit date: | 2000-05-07 | | Release date: | 2000-06-09 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the interaction of the fluorescence probe 8-anilino-1-naphthalene sulfonate (ANS) with the antibiotic target MurA.
Proc.Natl.Acad.Sci.USA, 97, 2000
|
|
2Z2R
 | | Nucleosome assembly proteins I (NAP-1, 74-365) | | Descriptor: | Nucleosome assembly protein | | Authors: | Park, Y.J, Luger, K. | | Deposit date: | 2007-05-25 | | Release date: | 2008-03-11 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | A beta-hairpin comprising the nuclear localization sequence sustains the self-associated states of nucleosome assembly protein 1
J.Mol.Biol., 375, 2008
|
|
1F66
 | | 2.6 A CRYSTAL STRUCTURE OF A NUCLEOSOME CORE PARTICLE CONTAINING THE VARIANT HISTONE H2A.Z | | Descriptor: | HISTONE H2A.Z, HISTONE H2B, HISTONE H3, ... | | Authors: | Suto, R.K, Clarkson, M.J, Tremethick, D.J, Luger, K. | | Deposit date: | 2000-06-20 | | Release date: | 2000-11-27 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.
Nat.Struct.Biol., 7, 2000
|
|
1ID3
 | | CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | | Authors: | White, C.L, Suto, R.K, Luger, K. | | Deposit date: | 2001-04-03 | | Release date: | 2001-09-28 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
|
|
1M18
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
1M19
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
1DLG
 | | CRYSTAL STRUCTURE OF THE C115S ENTEROBACTER CLOACAE MURA IN THE UN-LIGANDED STATE | | Descriptor: | CYCLOHEXYLAMMONIUM ION, PHOSPHATE ION, UDP-N-ACETYLGLUCOSAMINE ENOLPYRUVYL TRANSFERASE MURA | | Authors: | Schonbrunn, E, Eschenburg, S, Krekel, F, Luger, K, Amrhein, N. | | Deposit date: | 1999-12-09 | | Release date: | 2000-04-12 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Role of the loop containing residue 115 in the induced-fit mechanism of the bacterial cell wall biosynthetic enzyme MurA.
Biochemistry, 39, 2000
|
|
1P3L
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3P
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3G
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3A
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3I
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3M
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P34
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3K
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3B
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3F
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3O
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.75 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1M1A
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.MOL.BIOL., 326, 2003
|
|
