6RQZ
 
 | | GOLGI ALPHA-MANNOSIDASE II complex with Manno-epi-cyclophellitol aziridine | | Descriptor: | (1~{R},2~{S},3~{R},4~{R},5~{S},6~{R})-5-azanyl-6-(hydroxymethyl)cyclohexane-1,2,3,4-tetrol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, Debets, M, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-16 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.53 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRW
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2R,3R,4R,5S)-1-(5-{[4-(3,4-Dihydro-2H-1,5-benzodioxepin-7-yl)benzyl]oxy}pentyl)-2-(hydroxymethyl)-3,4,5-piperidinetriol | | Descriptor: | (2~{R},3~{R},4~{R},5~{S})-1-[5-[[4-(3,4-dihydro-2~{H}-1,5-benzodioxepin-7-yl)phenyl]methoxy]pentyl]-2-(hydroxymethyl)piperidine-3,4,5-triol, Alpha-mannosidase 2, ZINC ION | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRH
 | | GOLGI ALPHA-MANNOSIDASE II | | Descriptor: | 1,2-ETHANEDIOL, Alpha-mannosidase 2, ZINC ION | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-18 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRY
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3R)-2-(Hydroxymethyl)-1,2,3,6-tetrahydro-3-pyridinol | | Descriptor: | (2~{S},3~{R})-2-(hydroxymethyl)-1,2,3,6-tetrahydropyridin-3-ol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.86 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRX
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3R)-2-(Hydroxymethyl)-3-piperidinol | | Descriptor: | (2~{S},3~{R})-2-(hydroxymethyl)piperidin-3-ol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RS0
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3S,4R,5R)-1-(2-(Benzyloxy)ethyl)-2-(hydroxymethyl)piperidine-3,4,5-triol | | Descriptor: | (2~{S},3~{S},4~{R})-2-(hydroxymethyl)-1-(2-phenylmethoxyethyl)piperidine-3,4,5-triol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RPC
 | | GOLGI ALPHA-MANNOSIDASE II | | Descriptor: | 1,2-ETHANEDIOL, Alpha-mannosidase 2, SUCCINIC ACID, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, Debets, M, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-14 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
3JRF
 | |
6YSN
 | | Human TRPC5 in complex with Pico145 (HC-608) | | Descriptor: | 7-[(4-chlorophenyl)methyl]-3-methyl-1-(3-oxidanylpropyl)-8-[3-(trifluoromethyloxy)phenoxy]purine-2,6-dione, Maltose/maltodextrin-binding periplasmic protein,Short transient receptor potential channel 5 | | Authors: | Wright, D.J, Johnson, R.M, Muench, S.P, Bon, R.S. | | Deposit date: | 2020-04-22 | | Release date: | 2020-12-02 | | Last modified: | 2020-12-09 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Human TRPC5 structures reveal interaction of a xanthine-based TRPC1/4/5 inhibitor with a conserved lipid binding site.
Commun Biol, 3, 2020
|
|
3JRH
 | |
3IV5
 | |
3JR9
 | |
3MFI
 | | DNA Polymerase Eta in Complex With a cis-syn Thymidine Dimer | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*GP*TP*CP*CP*TP*CP*CP*CP*CP*TP*(DOC))-3', 5'-D(*TP*AP*AP*(TTD)P*GP*AP*GP*GP*GP*GP*AP*GP*GP*AP*C)-3', ... | | Authors: | Silverstein, T.D, Johnson, R.E, Jain, R, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2010-04-02 | | Release date: | 2010-06-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | Structural basis for the suppression of skin cancers by DNA polymerase eta.
Nature, 465, 2010
|
|
3JRC
 | |
3JRI
 | |
3JRG
 | |
3JRA
 | |
3JRD
 | |
3JRE
 | |
3JRB
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
3MFH
 | | DNA Polymerase Eta in Complex With Undamaged DNA | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*GP*TP*CP*CP*TP*CP*CP*CP*CP*TP*(DOC))-3', 5'-D(*TP*AP*AP*TP*TP*GP*AP*GP*GP*GP*GP*AP*GP*GP*AP*C)-3', ... | | Authors: | Silverstein, T.D, Johnson, R.E, Jain, R, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2010-04-02 | | Release date: | 2010-06-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural basis for the suppression of skin cancers by DNA polymerase eta.
Nature, 465, 2010
|
|
5DS9
 | |
5E3O
 | |
5E3N
 | |
