6YDV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ydv by Molmil](/molmil-images/mine/6ydv) | Crystal Structure of the Jmjc Domain of Human JMJD1B in complex with FM001511a from the DSPL fragment library | Descriptor: | CHLORIDE ION, JMJD1B protein, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-21 | Release date: | 2020-05-06 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | Crystal Structure of the Jmjc Domain of Human JMJD1B in complex with FM001511a from the DSPL fragment library To Be Published
|
|
5A1F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5a1f by Molmil](/molmil-images/mine/5a1f) | Crystal structure of the catalytic domain of PLU1 in complex with N-oxalylglycine. | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | Authors: | Srikannathasan, V, Johansson, C, Strain-Damerell, C, Gileadi, C, Szykowska, A, Kupinska, K, Kopec, J, Krojer, T, Steuber, H, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2015-04-29 | Release date: | 2015-05-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development. Nat.Chem.Biol., 12, 2016
|
|
5A3T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5a3t by Molmil](/molmil-images/mine/5a3t) | Crystal structure of human PLU-1 (JARID1B) in complex with KDM5-C49 (2-(((2-((2-(dimethylamino)ethyl)(ethyl)amino)-2-oxoethyl)amino)methyl) isonicotinic acid). | Descriptor: | 1,2-ETHANEDIOL, 2-{[(2-{[(E)-2-(dimethylamino)ethenyl](ethyl)amino}-2-oxoethyl)amino]methyl}pyridine-4-carboxylic acid, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Kopec, J, Strain-Damerell, C, Kupinska, K, BurgessBrown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2015-06-02 | Release date: | 2015-06-17 | Last modified: | 2016-06-29 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development. Nat.Chem.Biol., 12, 2016
|
|
5A3W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5a3w by Molmil](/molmil-images/mine/5a3w) | Crystal structure of human PLU-1 (JARID1B) in complex with Pyridine-2, 6-dicarboxylic Acid (PDCA) | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Kopec, J, Strain-Damerell, C, Kupinska, K, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2015-06-03 | Release date: | 2015-06-17 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development. Nat.Chem.Biol., 12, 2016
|
|
5A1H
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5a1h by Molmil](/molmil-images/mine/5a1h) | Crystal structure of human Spindlin3 | Descriptor: | SPINDLIN-3 | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Shrestha, L, Tallon, R, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | Deposit date: | 2015-04-30 | Release date: | 2015-06-17 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Crystal Structure of Human Spindlin3 To be Published
|
|
5A1L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5a1l by Molmil](/molmil-images/mine/5a1l) | Crystal structure of JmjC domain of human histone demethylase UTY with S21056a | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propan-1-ol, FE (II) ION, ... | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Krojer, T, Tumber, A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Brennan, P, Oppermann, U. | Deposit date: | 2015-05-01 | Release date: | 2015-06-17 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Crystal Structure of Jmjc Domain of Human Histone Demethylase Uty with S21056A To be Published
|
|
3OP3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3op3 by Molmil](/molmil-images/mine/3op3) | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens | Descriptor: | M-phase inducer phosphatase 3, SULFATE ION | Authors: | Kim, Y, Weger, A, Hatzos, C, Savitsky, P, Johansson, C, Ball, L, Barr, A, Vollmar, M, Muniz, J, Weigelt, J, Arrowsmith, C.H, Edwards, A, Bountra, C, Gileadi, O, von Delft, F, Knapp, S, Joachimiak, A, Structural Genomics Consortium (SGC) | Deposit date: | 2010-08-31 | Release date: | 2010-09-29 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens TO BE PUBLISHED
|
|
3P1M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3p1m by Molmil](/molmil-images/mine/3p1m) | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster | Descriptor: | Adrenodoxin, mitochondrial, CITRATE ANION, ... | Authors: | Chaikuad, A, Johansson, C, Krojer, T, Yue, W.W, Phillips, C, Bray, J.E, Pike, A.C.W, Muniz, J.R.C, Vollmar, M, Weigelt, J, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Kavanagh, K, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2010-09-30 | Release date: | 2010-11-03 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.54 Å) | Cite: | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster To be Published
|
|
6GPJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6gpj by Molmil](/molmil-images/mine/6gpj) | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4F-Man | Descriptor: | 1,2-ETHANEDIOL, CITRIC ACID, GDP-mannose 4,6 dehydratase, ... | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2018-06-06 | Release date: | 2018-07-18 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase. Acs Catalysis, 9, 2019
|
|
6GPL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6gpl by Molmil](/molmil-images/mine/6gpl) | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4k6d-Man | Descriptor: | 1,2-ETHANEDIOL, BICINE, GDP-mannose 4,6 dehydratase, ... | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2018-06-06 | Release date: | 2018-07-18 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase. Acs Catalysis, 9, 2019
|
|
6GPK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6gpk by Molmil](/molmil-images/mine/6gpk) | Crystal structure of human GDP-D-mannose 4,6-dehydratase (E157Q) in complex with GDP-Man | Descriptor: | 1,2-ETHANEDIOL, GDP-mannose 4,6 dehydratase, GLYCEROL, ... | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2018-06-06 | Release date: | 2018-07-18 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (1.47 Å) | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase. Acs Catalysis, 9, 2019
|
|
1ZSY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1zsy by Molmil](/molmil-images/mine/1zsy) | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63) | Descriptor: | GLYCEROL, MITOCHONDRIAL 2-ENOYL THIOESTER REDUCTASE, SULFATE ION | Authors: | Lukacik, P, Shafqat, N, Kavanagh, K.L, Johansson, C, Smee, C, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2005-05-25 | Release date: | 2005-06-07 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63) To be Published
|
|
2C46
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2c46 by Molmil](/molmil-images/mine/2c46) | CRYSTAL STRUCTURE OF THE HUMAN RNA guanylyltransferase and 5'- phosphatase | Descriptor: | MRNA CAPPING ENZYME | Authors: | Debreczeni, J, Johansson, C, Longman, E, Gileadi, O, SavitskySmee, P, Smee, C, Bunkoczi, G, Ugochukwu, E, von Delft, F, Sundstrom, M, Weigelt, J, Arrowsmith, C, Edwards, A, Knapp, S. | Deposit date: | 2005-10-15 | Release date: | 2005-11-01 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal Structure of the Human RNA Guanylyltransferase and 5'-Phosphatase To be Published
|
|
2FV8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fv8 by Molmil](/molmil-images/mine/2fv8) | The crystal structure of RhoB in the GDP-bound state | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, Rho-related GTP-binding protein RhoB | Authors: | Turnbull, A.P, Soundararajan, M, Smee, C, Johansson, C, Schoch, G, Gorrec, F, Bray, J, Papagrigoriou, E, von Delft, F, Weigelt, J, Edwards, A, Arrowsmith, C, Sundstrom, M, Doyle, D, Structural Genomics Consortium (SGC) | Deposit date: | 2006-01-30 | Release date: | 2006-02-28 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The crystal structure of RhoB in the GDP-bound state To be Published
|
|
2F5Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2f5y by Molmil](/molmil-images/mine/2f5y) | Crystal Structure of the PDZ Domain from Human RGS-3 | Descriptor: | SULFATE ION, regulator of G-protein signalling 3 isoform 1 | Authors: | Ugochukwu, E, Berridge, G, Johansson, C, Smee, C, Savitsky, P, Burgess, N, Colebrook, S, Yang, X, Elkins, J, Doyle, D, Turnbull, A, Papagrigoriou, E, Debreczeni, J, Bunkoczi, G, Gorrec, F, von Delft, F, Arrowsmith, C, Sundstrom, M, Weigelt, J, Edwards, A, Structural Genomics Consortium (SGC) | Deposit date: | 2005-11-28 | Release date: | 2005-12-13 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.39 Å) | Cite: | Crystal Structure of the PDZ Domain from Human RGS-3 To be Published
|
|
1ZSV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1zsv by Molmil](/molmil-images/mine/1zsv) | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase | Descriptor: | CHLORIDE ION, NADP-dependent leukotriene B4 12-hydroxydehydrogenase | Authors: | Turnbull, A.P, Johansson, C, Savitsky, P, Guo, K, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2005-05-25 | Release date: | 2005-06-21 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase To be Published
|
|
2CLP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2clp by Molmil](/molmil-images/mine/2clp) | Crystal structure of human aflatoxin B1 aldehyde reductase member 3 | Descriptor: | AFLATOXIN B1 ALDEHYDE REDUCTASE MEMBER 3, CALCIUM ION, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | Authors: | Debreczeni, J.E, Marsden, B.D, Johansson, C, Kavanagh, K, Guo, K, Smee, C, Gileadi, O, Turnbull, A, Papagrigoriou, E, von Delft, F, Edwards, A, Arrowsmith, C, Weigelt, J, Sundstrom, M, Oppermann, U. | Deposit date: | 2006-04-28 | Release date: | 2006-05-12 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal Structure of Human Aflatoxin B1 Aldehyde Reductase Member 3 To be Published
|
|
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
1QWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwb by Molmil](/molmil-images/mine/1qwb) | |
3CYN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3cyn by Molmil](/molmil-images/mine/3cyn) | The structure of human GPX8 | Descriptor: | GLYCEROL, Probable glutathione peroxidase 8, SULFATE ION | Authors: | Kavanagh, K.L, Johansson, C, Yue, W.W, Kochan, G, Pike, A.C.W, Murray, J, Roos, A.K, Filippakopoulos, P, von Delft, F, Arrowsmith, C.H, Wikstrom, M, Edwards, A.M, Bountra, C, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2008-04-25 | Release date: | 2008-08-12 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The structure of human GPX8 To be Published
|
|
2CFY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2cfy by Molmil](/molmil-images/mine/2cfy) | Crystal structure of human thioredoxin reductase 1 | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, THIOREDOXIN REDUCTASE 1 | Authors: | Debreczeni, J.E, Johansson, C, Kavanagh, K, Savitsky, P, Sundstrom, M, Arrowsmith, C, Weigelt, J, Edwards, A, von Delft, F, Oppermann, U. | Deposit date: | 2006-02-26 | Release date: | 2006-03-09 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal Structure of Human Thioredoxin Reductase 1 To be Published
|
|
2F8A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2f8a by Molmil](/molmil-images/mine/2f8a) | Crystal structure of the selenocysteine to glycine mutant of human glutathione peroxidase 1 | Descriptor: | Glutathione peroxidase 1, MALONIC ACID | Authors: | Kavanagh, K.L, Johansson, C, Smee, C, Gileadi, O, von Delft, F, Weigelt, J, Sundstrom, M, Edwards, A, Oppermann, U, Structural Genomics Consortium (SGC) | Deposit date: | 2005-12-02 | Release date: | 2005-12-13 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Crystal structure of the selenocysteine to glycine mutant of human glutathione peroxidase 1 To be Published
|
|
2EXE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2exe by Molmil](/molmil-images/mine/2exe) | Crystal structure of the phosphorylated CLK3 | Descriptor: | Dual specificity protein kinase CLK3 | Authors: | Papagrigoriou, E, Rellos, P, Das, S, Bullock, A, Ball, L.J, Turnbull, A, Savitsky, P, Fedorov, O, Johansson, C, Ugochukwu, E, Sobott, F, von Delft, F, Edwards, A, Sundstrom, M, Weigelt, J, Arrowsmith, C, Knapp, S, Structural Genomics Consortium (SGC) | Deposit date: | 2005-11-08 | Release date: | 2005-11-15 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Crystal structure of the phosphorylated CLK3 TO BE PUBLISHED
|
|
2VSP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2vsp by Molmil](/molmil-images/mine/2vsp) | Crystal structure of the fourth PDZ domain of PDZ domain-containing protein 1 | Descriptor: | PDZ DOMAIN-CONTAINING PROTEIN 1 | Authors: | Yue, W.W, Shafqat, N, Pilka, E.S, Johansson, C, Murray, J.W, Elkins, J, Roos, A, Cooper, C, Phillips, C, Salah, E, von Delft, F, Doyle, D, Edwards, A, Wikstrom, M, Arrowsmith, C, Bountra, C, Oppermann, U. | Deposit date: | 2008-04-28 | Release date: | 2009-03-03 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.41 Å) | Cite: | Crystal Structure of the Fourth Pdz Domain of Pdz Domain-Containing Protein 1 To be Published
|
|
2VNA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2vna by Molmil](/molmil-images/mine/2vna) | Structure of Human Zinc-binding Alcohol Dehydrogenase 1 (ZADH1) | Descriptor: | NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, PROSTAGLANDIN REDUCTASE 2 | Authors: | Shafqat, N, Kavanagh, K, Pike, A.C.W, Muniz, J.R.C, Pilka, E, Roos, A.K, Picaud, S, Johansson, C, Smee, C, Fedorov, O, Kochan, G, Edwards, A, Arrowsmith, C.H, Weigelt, J, Bountra, C, von Delft, F, Opperman, U. | Deposit date: | 2008-02-01 | Release date: | 2009-02-17 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.17 Å) | Cite: | Structure of Human Zinc-Binding Alcohol Dehydrogenase 1 (Zadh1) To be Published
|
|