5RAS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ras by Molmil](/molmil-images/mine/5ras) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS036302b | Descriptor: | 2-(4-phenylpiperidin-1-yl)ethanoic acid, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.58 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rae by Molmil](/molmil-images/mine/5rae) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001558a | Descriptor: | 3-[4-(4-hydroxyphenyl)phenyl]propanoic acid, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.88 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rav by Molmil](/molmil-images/mine/5rav) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001763a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.77 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5R7X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5r7x by Molmil](/molmil-images/mine/5r7x) | PanDDA analysis group deposition of ground-state model of Human JMJD1B | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.44 Å) | Cite: | PanDDA analysis group deposition of ground-state model for Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
5RAM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ram by Molmil](/molmil-images/mine/5ram) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS038544d | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb0 by Molmil](/molmil-images/mine/5rb0) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM010020a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rap by Molmil](/molmil-images/mine/5rap) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM000707a | Descriptor: | (3~{a}~{R},7~{a}~{R})-4-(4-methoxyphenyl)-2,3,3~{a},6,7,7~{a}-hexahydrothieno[3,2-c]pyridine, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb6 by Molmil](/molmil-images/mine/5rb6) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001569a | Descriptor: | 1-(4-chlorophenyl)-3-(2-methyl-1-oxidanyl-propan-2-yl)urea, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.63 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5raf by Molmil](/molmil-images/mine/5raf) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001559a | Descriptor: | (5~{R})-3,4,4-trimethyl-5-(oxidanylamino)-1,3-thiazolidine-2-thione, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.62 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rau by Molmil](/molmil-images/mine/5rau) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with DA000165b | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.73 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5raa by Molmil](/molmil-images/mine/5raa) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM009990a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.57 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5raq by Molmil](/molmil-images/mine/5raq) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001577a | Descriptor: | 2-[4-(2-methoxyphenyl)piperazin-1-yl]ethanenitrile, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb7 by Molmil](/molmil-images/mine/5rb7) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001648a | Descriptor: | (1R,3S)-N-[(2H-1,3-benzodioxol-5-yl)methyl]-3-methylcyclopentan-1-amine, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.57 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
2NLK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2nlk by Molmil](/molmil-images/mine/2nlk) | Crystal structure of D1 and D2 catalytic domains of human Protein Tyrosine Phosphatase Gamma (D1+D2 PTPRG) | Descriptor: | Protein tyrosine phosphatase, receptor type, G variant (Fragment) | Authors: | Filippakopoulos, P, Gileadi, O, Johansson, C, Ugochukwu, E, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Knapp, S, Structural Genomics Consortium (SGC) | Deposit date: | 2006-10-20 | Release date: | 2006-11-21 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Large-scale structural analysis of the classical human protein tyrosine phosphatome. Cell(Cambridge,Mass.), 136, 2009
|
|
5ORL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5orl by Molmil](/molmil-images/mine/5orl) | Crystal structure of Aurora-A kinase in complex with an allosterically binding fragment | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Aurora kinase A, CHLORIDE ION, ... | Authors: | McIntyre, P.J, Collins, P.M, Vrzal, L, Birchall, K, Arnold, L.H, Mpamhanga, C, Coombs, P.J, Burgess, S.G, Richards, M.W, Winter, A, Veverka, V, von Delft, F, Merritt, A, Bayliss, R. | Deposit date: | 2017-08-16 | Release date: | 2017-11-01 | Last modified: | 2017-11-29 | Method: | X-RAY DIFFRACTION (1.69 Å) | Cite: | Characterization of Three Druggable Hot-Spots in the Aurora-A/TPX2 Interaction Using Biochemical, Biophysical, and Fragment-Based Approaches. ACS Chem. Biol., 12, 2017
|
|
5OYM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5oym by Molmil](/molmil-images/mine/5oym) | HIV Integrase Binding Domain of Lens Epithelium-Derived Growth Factor | Descriptor: | PC4 and SFRS1-interacting protein | Authors: | Rabbitts, T.H, Phillips, S.E.V, Cruz-Migoni, A, Carr, S.B, Hannon, C. | Deposit date: | 2017-09-11 | Release date: | 2018-03-07 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Cloning, purification and structure determination of the HIV integrase-binding domain of lens epithelium-derived growth factor. Acta Crystallogr F Struct Biol Commun, 74, 2018
|
|
2JMH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jmh by Molmil](/molmil-images/mine/2jmh) | NMR solution structure of Blo t 5, a major mite allergen from Blomia tropicalis | Descriptor: | Mite allergen Blo t 5 | Authors: | Naik, M.T, Chang, C, Kuo, I, Chua, K, Huang, T. | Deposit date: | 2006-11-12 | Release date: | 2007-11-13 | Last modified: | 2023-12-20 | Method: | SOLUTION NMR | Cite: | Roles of Structure and Structural Dynamics in the Antibody Recognition of the Allergen Proteins: An NMR Study on Blomia tropicalis Major Allergen Structure, 16, 2008
|
|
1EF2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ef2 by Molmil](/molmil-images/mine/1ef2) | CRYSTAL STRUCTURE OF MANGANESE-SUBSTITUTED KLEBSIELLA AEROGENES UREASE | Descriptor: | MANGANESE (II) ION, UREASE ALPHA SUBUNIT, UREASE BETA SUBUNIT, ... | Authors: | Yamaguchi, K, Cosper, N.J, Stalhandske, C, Scott, R.A, Pearson, M.A, Karplus, P.A, Hausinger, R.P. | Deposit date: | 2000-02-05 | Release date: | 2000-03-09 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Characterization of metal-substituted Klebsiella aerogenes urease. J.Biol.Inorg.Chem., 4, 1999
|
|
2J8Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2j8z by Molmil](/molmil-images/mine/2j8z) | Crystal Structure of human P53 inducible oxidoreductase (TP53I3,PIG3) | Descriptor: | NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, QUINONE OXIDOREDUCTASE | Authors: | Pike, A.C.W, Shafqat, N, Debreczeni, J, Johansson, C, Haroniti, A, Gileadi, O, Arrowsmith, C.H, Edwards, A, Weigelt, J, Sundstrom, M, von Delft, F, Porte, S, Fita, I, Pares, J, Pares, X, Oppermann, U. | Deposit date: | 2006-10-31 | Release date: | 2006-11-06 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Three-Dimensional Structure and Enzymatic Function of Proapoptotic Human P53-Inducible Quinone Oxidoreductase Pig3. J.Biol.Chem., 284, 2009
|
|
1ECU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ecu by Molmil](/molmil-images/mine/1ecu) | SOLUTION STRUCTURE OF E2F BINDING DNA FRAGMENT GCGCGAAAC-T-GTTTCGCGC | Descriptor: | DNA (5'-D(*GP*CP*GP*CP*GP*AP*AP*AP*CP*TP*GP*TP*TP*TP*CP*GP*CP*GP*C)-3') | Authors: | Wu, J.H, Chang, C, Pei, J.M, Xiao, Q, Shi, Y.Y. | Deposit date: | 2000-01-26 | Release date: | 2000-02-02 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of E2F binding DNA fragment GCGCGAAAC-T-GTTTCGCGC studied by Molecular Dynamics Simulation and Two Dimensional NMR experiment to be published, 2000
|
|
1DGS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1dgs by Molmil](/molmil-images/mine/1dgs) | CRYSTAL STRUCTURE OF NAD+-DEPENDENT DNA LIGASE FROM T. FILIFORMIS | Descriptor: | ADENOSINE MONOPHOSPHATE, DNA LIGASE, ZINC ION | Authors: | Lee, J.Y, Chang, C, Song, H.K, Kwon, S.T, Suh, S.W. | Deposit date: | 1999-11-25 | Release date: | 2000-11-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of NAD(+)-dependent DNA ligase: modular architecture and functional implications. EMBO J., 19, 2000
|
|
1HQV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hqv by Molmil](/molmil-images/mine/1hqv) | STRUCTURE OF APOPTOSIS-LINKED PROTEIN ALG-2 | Descriptor: | CALCIUM ION, PROGRAMMED CELL DEATH PROTEIN 6 | Authors: | Jia, J, Tarabykina, S, Hansen, C, Berchtold, M, Cygler, M. | Deposit date: | 2000-12-19 | Release date: | 2001-05-02 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structure of apoptosis-linked protein ALG-2: insights into Ca2+-induced changes in penta-EF-hand proteins. Structure, 9, 2001
|
|
4KGQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kgq by Molmil](/molmil-images/mine/4kgq) | Crystal structure of a human light loop mutant in complex with dcr3 | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, MAGNESIUM ION, Tumor necrosis factor ligand superfamily member 14, ... | Authors: | Liu, W, Zhan, C, Bonanno, J.B, Sampathkumar, P, Toro, R, Nathenson, S.G, Almo, S.C, New York Structural Genomics Research Consortium (NYSGRC), Atoms-to-Animals: The Immune Function Network (IFN) | Deposit date: | 2013-04-29 | Release date: | 2013-07-10 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.27 Å) | Cite: | Mechanistic basis for functional promiscuity in the TNF and TNF receptor superfamilies: structure of the LIGHT:DcR3 assembly. Structure, 22, 2014
|
|
4L7T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4l7t by Molmil](/molmil-images/mine/4l7t) | B. fragilis NanU | Descriptor: | 1,2-ETHANEDIOL, ACETATE ION, NanU sialic acid binding protein, ... | Authors: | Rafferty, J.B, Phansopa, C, Stafford, G.P. | Deposit date: | 2013-06-14 | Release date: | 2014-01-01 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.61 Å) | Cite: | Structural and functional characterization of NanU, a novel high-affinity sialic acid-inducible binding protein of oral and gut-dwelling Bacteroidetes species. Biochem.J., 458, 2014
|
|