2QH3
 
 | |
2EUY
 | | Solution structure of the internal loop of human U65 H/ACA snoRNA 3' hairpin | | Descriptor: | U65 box H/ACA snoRNA | | Authors: | Feigon, J, Khanna, M, Wu, H, Johansson, C, Caizergues-Ferrer, M. | | Deposit date: | 2005-10-30 | | Release date: | 2006-01-03 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structural study of the H/ACA snoRNP components Nop10p and the 3' hairpin of U65 snoRNA.
Rna, 12, 2006
|
|
2QH4
 | |
2QH2
 | |
6TZN
 | | Structure of S. pombe telomerase accessory protein Pof8 C-terminal domain | | Descriptor: | NITRATE ION, Protein pof8 | | Authors: | Basu, R.S, Cascio, D, Eichhorn, C.D, Feigon, J. | | Deposit date: | 2019-08-12 | | Release date: | 2020-08-19 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.35 Å) | | Cite: | Structure of S. pombe telomerase protein Pof8 C-terminal domain is an xRRM conserved among LARP7 proteins.
Rna Biol., 18, 2021
|
|
8GAP
 | | Structure of LARP7 protein p65-telomerase RNA complex in telomerase | | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | | Authors: | Wang, Y, He, Y, Wang, Y, Yang, Y, Singh, M, Eichhorn, C.D, Zhou, Z.H, Feigon, J. | | Deposit date: | 2023-02-23 | | Release date: | 2023-06-28 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR.
J.Mol.Biol., 435, 2023
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
2DA8
 | | SOLUTION STRUCTURE OF A COMPLEX BETWEEN (N-MECYS3,N-MECYS7)TANDEM AND (D(GATATC))2 | | Descriptor: | 2-CARBOXYQUINOXALINE, CysMeTANDEM quinoxaline antibiotic, DNA (5'-D(*GP*AP*TP*AP*TP*C)-3') | | Authors: | Addess, K.J, Sinsheimer, J.S, Feigon, J. | | Deposit date: | 1993-04-09 | | Release date: | 1994-01-31 | | Last modified: | 2024-08-14 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Complex between [N-Mecys3,N-Mecys7]Tandem and [D(Gatatc)]2.
Biochemistry, 32, 1993
|
|
3EUD
 | | Structure of the CS domain of the essential H/ACA RNP assembly protein Shq1p | | Descriptor: | Protein SHQ1 | | Authors: | Singh, M, Cascio, D, Gonzales, F.A, Heckmann, N, Chanfreau, G, Feigon, J. | | Deposit date: | 2008-10-09 | | Release date: | 2008-11-18 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure and Functional Studies of the CS Domain of the Essential H/ACA Ribonucleoparticle Assembly Protein SHQ1.
J.Biol.Chem., 284, 2009
|
|
1YMO
 | |
7SLQ
 | | Cryo-EM structure of 7SK core RNP with circular RNA | | Descriptor: | 7SK snRNA methylphosphate capping enzyme, La-related protein 7, Minimal circular 7SK RNA, ... | | Authors: | Yang, Y, Liu, S, Zhou, Z.H, Feigon, J. | | Deposit date: | 2021-10-24 | | Release date: | 2022-03-30 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | Structural basis of RNA conformational switching in the transcriptional regulator 7SK RNP.
Mol.Cell, 82, 2022
|
|
7SLP
 | | Cryo-EM structure of 7SK core RNP with linear RNA | | Descriptor: | 7SK snRNA methylphosphate capping enzyme, La-related protein 7, Linear 7SK RNA, ... | | Authors: | Yang, Y, Liu, S, Zhou, Z.H, Feigon, J. | | Deposit date: | 2021-10-24 | | Release date: | 2022-03-30 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural basis of RNA conformational switching in the transcriptional regulator 7SK RNP.
Mol.Cell, 82, 2022
|
|
5DFM
 | | Structure of Tetrahymena telomerase p19 fused to MBP | | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | | Deposit date: | 2015-08-27 | | Release date: | 2015-10-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.301 Å) | | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions.
Science, 350, 2015
|
|
5DFN
 | | Structure of Tetrahymena Telomerase P45 C-terminal domain | | Descriptor: | Telomerase associated protein p45 | | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | | Deposit date: | 2015-08-27 | | Release date: | 2015-10-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.382 Å) | | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions.
Science, 350, 2015
|
|
7UY6
 | | Tetrahymena telomerase at 2.9 Angstrom resolution | | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | | Authors: | He, Y, Song, H, Chan, H, Wang, Y, Liu, B, Susac, L, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-05-06 | | Release date: | 2022-07-13 | | Last modified: | 2024-02-14 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Structure of Tetrahymena telomerase-bound CST with polymerase alpha-primase.
Nature, 608, 2022
|
|
7UY7
 | | Tetrahymena CST with Polymerase alpha-Primase | | Descriptor: | DNA polymerase, Telomerase associated protein p50, Telomerase-associated protein of 19 kDa, ... | | Authors: | He, Y, Song, H, Chan, H, Wang, Y, Liu, B, Susac, L, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-05-06 | | Release date: | 2022-07-13 | | Last modified: | 2024-02-14 | | Method: | ELECTRON MICROSCOPY (4.2 Å) | | Cite: | Structure of Tetrahymena telomerase-bound CST with polymerase alpha-primase.
Nature, 608, 2022
|
|
7UY8
 | | Tetrahymena Polymerase alpha-Primase | | Descriptor: | DNA polymerase, DNA polymerase alpha subunit B, DNA primase, ... | | Authors: | He, Y, Song, H, Chan, H, Wang, Y, Liu, B, Susac, L, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-05-06 | | Release date: | 2022-07-13 | | Last modified: | 2024-02-14 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | Structure of Tetrahymena telomerase-bound CST with polymerase alpha-primase.
Nature, 608, 2022
|
|
7UY5
 | | Tetrahymena telomerase with CST | | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | | Authors: | He, Y, Song, H, Chan, H, Wang, Y, Liu, B, Susac, L, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-05-06 | | Release date: | 2022-07-13 | | Last modified: | 2024-02-14 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structure of Tetrahymena telomerase-bound CST with polymerase alpha-primase.
Nature, 608, 2022
|
|
156D
 | |
5KMZ
 | |
1WAN
 | | DNA DTA TRIPLEX, NMR, 7 STRUCTURES | | Descriptor: | DNA (5'-D(*AP*GP*AP*TP*AP*GP*AP*AP*CP*CP*CP*CP*TP*TP*CP*TP*AP*TP*CP*TP*TP*AP*TP*AP*TP*CP*TP*(D3)P*TP*CP*TP*T)-3') | | Authors: | Wang, E, Koshlap, K.M, Gillespie, P, Dervan, P.B, Feigon, J. | | Deposit date: | 1996-01-14 | | Release date: | 1996-07-11 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of a pyrimidine-purine-pyrimidine triplex containing the sequence-specific intercalating non-natural base D3.
J.Mol.Biol., 257, 1996
|
|
7TRD
 | | Human telomerase catalytic core structure at 3.3 Angstrom | | Descriptor: | Telomerase RNA, partial sequence, Telomerase reverse transcriptase, ... | | Authors: | Liu, B, He, Y, Wang, Y, Song, H, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-01-28 | | Release date: | 2022-04-20 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Structure of active human telomerase with telomere shelterin protein TPP1.
Nature, 604, 2022
|
|
7TRE
 | | Human telomerase catalytic core with shelterin protein TPP1 | | Descriptor: | Adrenocortical dysplasia protein homolog, Telomerase RNA, partial sequence, ... | | Authors: | Liu, B, He, Y, Wang, Y, Song, H, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-01-28 | | Release date: | 2022-04-20 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structure of active human telomerase with telomere shelterin protein TPP1.
Nature, 604, 2022
|
|
7TRF
 | | Human telomerase catalytic core RNP with H2A/H2B | | Descriptor: | Histone H2A, Histone H2B type 1-C/E/F/G/I, Telomerase RNA, ... | | Authors: | Liu, B, He, Y, Wang, Y, Song, H, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-01-28 | | Release date: | 2022-04-20 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | Structure of active human telomerase with telomere shelterin protein TPP1.
Nature, 604, 2022
|
|
7TRC
 | | Human telomerase H/ACA RNP at 3.3 Angstrom | | Descriptor: | H/ACA ribonucleoprotein complex subunit 1, H/ACA ribonucleoprotein complex subunit 2, H/ACA ribonucleoprotein complex subunit 3, ... | | Authors: | Liu, B, He, Y, Wang, Y, Song, H, Zhou, Z.H, Feigon, J. | | Deposit date: | 2022-01-28 | | Release date: | 2022-04-20 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Structure of active human telomerase with telomere shelterin protein TPP1.
Nature, 604, 2022
|
|
