7LDK
 
 | | Structure of human respiratory syncytial virus nonstructural protein 2 (NS2) | | Descriptor: | CHLORIDE ION, D(-)-TARTARIC ACID, Non-structural protein 2 | | Authors: | Chatterjee, S, Borek, D, Otwinowski, Z, Amarasinghe, G.K, Leung, D.W. | | Deposit date: | 2021-01-13 | | Release date: | 2021-03-17 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.82 Å) | | Cite: | Structural basis for IFN antagonism by human respiratory syncytial virus nonstructural protein 2.
Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
1B4F
 | |
1B0M
 | | ACONITASE R644Q:FLUOROCITRATE COMPLEX | | Descriptor: | CITRATE ANION, IRON/SULFUR CLUSTER, PROTEIN (ACONITASE) | | Authors: | Lloyd, S.J, Lauble, H, Prasad, G.S, Stout, C.D. | | Deposit date: | 1998-11-11 | | Release date: | 1998-11-18 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | The mechanism of aconitase: 1.8 A resolution crystal structure of the S642a:citrate complex.
Protein Sci., 8, 1999
|
|
5ADZ
 | | Ether Lipid-Generating Enzyme AGPS in complex with inhibitor 1a | | Descriptor: | (3S)-3-(2-fluorophenyl)-N-((2-oxo-2,3-dihydro-1H-benzo[d]imidazol-5-yl)methyl)butanamide), ALKYLDIHYDROXYACETONEPHOSPHATE SYNTHASE, PEROXISOMAL, ... | | Authors: | Piano, V, Benjamin, D.I, Valente, S, Nenci, S, Marrocco, B, Mai, A, Aliverti, A, Nomura, D.K, Mattevi, A. | | Deposit date: | 2015-08-25 | | Release date: | 2015-09-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Discovery of Inhibitors for the Ether Lipid-Generating Enzyme Agps as Anti-Cancer Agents.
Acs Chem.Biol., 10, 2015
|
|
1B70
 | | PHENYLALANYL TRNA SYNTHETASE COMPLEXED WITH PHENYLALANINE | | Descriptor: | MAGNESIUM ION, PHENYLALANINE, PHENYLALANYL-TRNA SYNTHETASE | | Authors: | Reshetnikova, L, Moor, N, Lavrik, O, Vassylyev, D.G. | | Deposit date: | 1999-01-26 | | Release date: | 2000-02-09 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of phenylalanyl-tRNA synthetase complexed with phenylalanine and a phenylalanyl-adenylate analogue
J.Mol.Biol., 287, 1999
|
|
1B4L
 | | 15 ATMOSPHERE OXYGEN YEAST CU/ZN SUPEROXIDE DISMUTASE ROOM TEMPERATURE (298K) STRUCTURE | | Descriptor: | COPPER (II) ION, PROTEIN (CU/ZN SUPEROXIDE DISMUTASE), ZINC ION | | Authors: | Hart, P.J, Balbirnie, M.M, Ogihara, N.L, Nersissian, A.M, Weiss, M.S, Valentine, J.S, Eisenberg, D. | | Deposit date: | 1998-12-22 | | Release date: | 1999-12-23 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | A structure-based mechanism for copper-zinc superoxide dismutase.
Biochemistry, 38, 1999
|
|
1B8R
 | | PARVALBUMIN | | Descriptor: | CALCIUM ION, PROTEIN (PARVALBUMIN) | | Authors: | Cates, M.S, Berry, M.B, Ho, E.L, Li, Q, Potter, J.D, Phillips Jr, G.N. | | Deposit date: | 1999-02-02 | | Release date: | 1999-02-09 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Metal-ion affinity and specificity in EF-hand proteins: coordination geometry and domain plasticity in parvalbumin.
Structure Fold.Des., 7, 1999
|
|
5ABJ
 | | Structure of Coxsackievirus A16 in complex with GPP3 | | Descriptor: | 1-[(3S)-5-[4-[(E)-ETHOXYIMINOMETHYL]PHENOXY]-3-METHYL-PENTYL]-3-PYRIDIN-4-YL-IMIDAZOLIDIN-2-ONE, CHLORIDE ION, SODIUM ION, ... | | Authors: | De Colibus, L, Wang, X, Tijsma, A, Neyts, J, Spyrou, J.A.B, Ren, J, Grimes, J.M, Puerstinger, G, Leyssen, P, Fry, E.E, Rao, Z, Stuart, D.I. | | Deposit date: | 2015-08-06 | | Release date: | 2015-09-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.75 Å) | | Cite: | Structure Elucidation of Coxsackievirus A16 in Complex with Gpp3 Informs a Systematic Review of Highly Potent Capsid Binders to Enteroviruses.
Plos Pathog., 11, 2015
|
|
5A1A
 | | 2.2 A resolution cryo-EM structure of beta-galactosidase in complex with a cell-permeant inhibitor | | Descriptor: | 2-phenylethyl 1-thio-beta-D-galactopyranoside, BETA-GALACTOSIDASE, MAGNESIUM ION, ... | | Authors: | Bartesaghi, A, Merk, A, Banerjee, S, Matthies, D, Wu, X, Milne, J, Subramaniam, S. | | Deposit date: | 2015-04-29 | | Release date: | 2015-05-06 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (2.2 Å) | | Cite: | 2.2 A Resolution Cryo-Em Structure of Beta-Galactosidase in Complex with a Cell-Permeant Inhibitor
Science, 348, 2015
|
|
5A2I
 | | Crystal structure of scFv-SM3 in complex with APD-SGalNAc-RP | | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-alpha-D-galactopyranose, ANTIGEN TN, ... | | Authors: | Martinez-Saez, N, Castro-Lopez, J, Valero-Gonzalez, J, Madariaga, D, Companon, I, Somovilla, V.J, Salvado, M, Asensio, J.L, Jimenez-Barbero, J, Avenoza, A, Busto, J.H, Bernardes, G.J.L, Peregrina, J.M, Hurtado-Guerrero, R, Corzana, F. | | Deposit date: | 2015-05-20 | | Release date: | 2015-06-03 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.88 Å) | | Cite: | Deciphering the Non-Equivalence of Serine and Threonine O-Glycosylation Points: Implications for Molecular Recognition of the Tn Antigen by an Anti-Muc1 Antibody.
Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
7LJU
 | | Porcine Dihydropyrimidine Dehydrogenase (DPD) crosslinked with 5-Ethynyluracil (5EU) | | Descriptor: | 1-DEOXY-1-(7,8-DIMETHYL-2,4-DIOXO-3,4-DIHYDRO-2H-BENZO[G]PTERIDIN-1-ID-10(5H)-YL)-5-O-PHOSPHONATO-D-RIBITOL, 5-ethynylpyrimidine-2,4(1H,3H)-dione, Dihydropyrimidine dehydrogenase [NADP(+)], ... | | Authors: | Butrin, A, Forouzesh, D, Beaupre, B, Wawrzak, Z, Liu, D, Moran, G. | | Deposit date: | 2021-01-30 | | Release date: | 2021-04-07 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.87 Å) | | Cite: | The Interaction of Porcine Dihydropyrimidine Dehydrogenase with the Chemotherapy Sensitizer: 5-Ethynyluracil.
Biochemistry, 60, 2021
|
|
3M3E
 | |
3MUG
 | | Crystal structure of human Fab PG16, a broadly reactive and potent HIV-1 neutralizing antibody | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Antibody PG16 Heavy Chain, ... | | Authors: | Pejchal, R, Walker, L.M, Burton, D.R, Wilson, I.A. | | Deposit date: | 2010-05-03 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.49 Å) | | Cite: | Structure and function of broadly reactive antibody PG16 reveal an H3 subdomain that mediates potent neutralization of HIV-1.
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
5UK2
 | | CryoEM structure of an influenza virus receptor-binding site antibody-antigen interface - Class 4 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Hemagglutinin HA1, ... | | Authors: | Liu, Y, Pan, J, Caradonna, T, Jenni, S, Raymond, D.D, Schmidt, A.G, Harrison, S.C, Grigorieff, N. | | Deposit date: | 2017-01-19 | | Release date: | 2017-05-31 | | Last modified: | 2020-07-29 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | CryoEM Structure of an Influenza Virus Receptor-Binding Site Antibody-Antigen Interface.
J. Mol. Biol., 429, 2017
|
|
5UJZ
 | | CryoEM structure of an influenza virus receptor-binding site antibody-antigen interface - Class 1 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Hemagglutinin HA1, ... | | Authors: | Liu, Y, Pan, J, Caradonna, T, Jenni, S, Raymond, D.D, Schmidt, A.G, Harrison, S.C, Grigorieff, N. | | Deposit date: | 2017-01-19 | | Release date: | 2017-05-31 | | Last modified: | 2020-07-29 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | CryoEM Structure of an Influenza Virus Receptor-Binding Site Antibody-Antigen Interface.
J. Mol. Biol., 429, 2017
|
|
6NIG
 | | Crystal structure of the human TLR2-Diprovocim complex | | Descriptor: | (3S,4S,3'S,4'S)-1,1'-(1,4-phenylenedicarbonyl)bis{N~3~,N~4~-bis[(1S,2R)-2-phenylcyclopropyl]pyrrolidine-3,4-dicarboxami de}, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Zhang, H, Beutler, B.A, Tomchick, D.R, Su, L. | | Deposit date: | 2018-12-27 | | Release date: | 2019-04-17 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim.
J. Med. Chem., 62, 2019
|
|
6NEA
 | | Human Acetylcholinesterase in complex with reactivator, HLo7 | | Descriptor: | 1-[({2,4-BIS[(E)-(HYDROXYIMINO)METHYL]PYRIDINIUM-1-YL}METHOXY)METHYL]-4-CARBAMOYLPYRIDINIUM, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[alpha-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Bester, S.M, McGuire, J, Height, J.J, Pegan, S.D. | | Deposit date: | 2018-12-17 | | Release date: | 2019-06-12 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.419 Å) | | Cite: | Synthesis and Molecular Properties of Nerve Agent Reactivator HLo-7 Dimethanesulfonate.
Acs Med.Chem.Lett., 10, 2019
|
|
5E0A
 | | Crystal Structure of the complex of Camel Peptidoglycan Recognition Protein (CPGRP-S) and N-Acetylglucosamine at 2.6 A | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, L(+)-TARTARIC ACID, Peptidoglycan recognition protein 1 | | Authors: | Dube, D, Sharma, P, Sinha, M, Kaur, P, Sharma, S, Singh, T.P. | | Deposit date: | 2015-09-28 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal Structure of the complex of Camel Peptidoglycan Recognition Protein (CPGRP-S) and N-Acetylglucosamine at 2.6 A
To Be Published
|
|
5W6G
 | | Human antibody 6649 in complex with influenza hemagglutinin H1 Solomon Islands | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 6649 antibody heavy chain, ... | | Authors: | Raymond, D.D, Harrison, S.C. | | Deposit date: | 2017-06-16 | | Release date: | 2017-12-20 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.79 Å) | | Cite: | Conserved epitope on influenza-virus hemagglutinin head defined by a vaccine-induced antibody.
Proc. Natl. Acad. Sci. U.S.A., 115, 2018
|
|
5DXH
 | | p110alpha/p85alpha with compound 5 | | Descriptor: | Phosphatidylinositol 3-kinase regulatory subunit alpha, Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform, methyl {2-[4-(2-chlorophenyl)-4H-1,2,4-triazol-3-yl]-4,5-dihydrothieno[3,2-d][1]benzoxepin-8-yl}carbamate | | Authors: | Heffron, T.P, Heald, R.A, Ndubaku, C, Wei, B.Q, Augustin, M, Do, S, Edgar, K, Eigenbrot, C, Friedman, L, Gancia, E, Jackson, P.S, Jones, G, Kolesnikov, A, Lee, L.B, Lesnick, J.D, Lewis, C, McLean, N, Mortle, M, Nonomiya, J, Pang, J, Price, S, Prior, W.W, Salphati, L, Sideris, S, Staben, S, Steinbacher, S, Tsui, V, Wallin, J, Sampath, D, Olivero, A. | | Deposit date: | 2015-09-23 | | Release date: | 2016-01-27 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Rational Design of Selective Benzoxazepin Inhibitors of the alpha-Isoform of Phosphoinositide 3-Kinase Culminating in the Identification of (S)-2-((2-(1-Isopropyl-1H-1,2,4-triazol-5-yl)-5,6-dihydrobenzo[f]imidazo[1,2-d][1,4]oxazepin-9-yl)oxy)propanamide (GDC-0326).
J.Med.Chem., 59, 2016
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
2YLA
 | | INHIBITION OF THE PNEUMOCOCCAL VIRULENCE FACTOR STRH AND MOLECULAR INSIGHTS INTO N-GLYCAN RECOGNITION AND HYDROLYSIS | | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-2)-alpha-D-mannopyranose-(1-3)-[2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)]beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-2)-alpha-D-mannopyranose-(1-3)-beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Pluvinage, B, Higgins, M.A, Abbott, D.W, Robb, C, Dalia, A.B, Deng, L, Weiser, J.N, Parsons, T.B, Fairbanks, A.J, Vocadlo, D.J, Boraston, A.B. | | Deposit date: | 2011-06-01 | | Release date: | 2011-09-07 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Inhibition of the Pneumococcal Virulence Factor Strh and Molecular Insights Into N-Glycan Recognition and Hydrolysis.
Structure, 19, 2011
|
|
2YOR
 | | Crystallization of a 45 kDa peroxygenase- peroxidase from the mushroom Agrocybe aegerita and structure determination by SAD utilizing only the haem iron | | Descriptor: | 1H-imidazol-5-ylmethanol, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Piontek, K, Strittmatter, E, Ullrich, R, Plattner, D.A, Hofrichter, M. | | Deposit date: | 2012-10-26 | | Release date: | 2013-10-23 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.19 Å) | | Cite: | Structural Basis of Substrate Conversion in a New Aromatic Peroxygenase: P450 Functionality with Benefits
J.Biol.Chem., 288, 2013
|
|
8IHR
 | | Cryo-EM structure of ochratoxin A-detoxifying amidohydrolase ADH3 in complex with Phe | | Descriptor: | Amidohydrolase family protein, PHENYLALANINE, ZINC ION | | Authors: | Dai, L.H, Niu, D, Huang, J.-W, Li, X, Shen, P.P, Li, H, Hu, Y.M, Yang, Y, Chen, C.-C, Guo, R.-T. | | Deposit date: | 2023-02-23 | | Release date: | 2023-08-30 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (2.5 Å) | | Cite: | Cryo-EM structure and rational engineering of a superefficient ochratoxin A-detoxifying amidohydrolase.
J Hazard Mater, 458, 2023
|
|
8IHQ
 | | Cryo-EM structure of ochratoxin A-detoxifying amidohydrolase ADH3 | | Descriptor: | Amidohydrolase family protein, ZINC ION | | Authors: | Dai, L.H, Niu, D, Huang, J.-W, Li, X, Shen, P.P, Li, H, Hu, Y.M, Yang, Y, Chen, C.-C, Guo, R.-T. | | Deposit date: | 2023-02-23 | | Release date: | 2023-08-30 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (2.71 Å) | | Cite: | Cryo-EM structure and rational engineering of a superefficient ochratoxin A-detoxifying amidohydrolase.
J Hazard Mater, 458, 2023
|
|
