5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5DTD
| |
5HA7
| Human Aldose Reductase in Complex with NADP+ and WY14643 in Space Group P212121 | Descriptor: | 2-({4-CHLORO-6-[(2,3-DIMETHYLPHENYL)AMINO]PYRIMIDIN-2-YL}SULFANYL)ACETIC ACID, Aldose reductase, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | Authors: | Sawaya, M.R, Cascio, D, Balendiran, G.K. | Deposit date: | 2015-12-30 | Release date: | 2016-09-28 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Characterization of WY 14,643 and its Complex with Aldose Reductase. Sci Rep, 6, 2016
|
|
5DFM
| Structure of Tetrahymena telomerase p19 fused to MBP | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | Deposit date: | 2015-08-27 | Release date: | 2015-10-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.301 Å) | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science, 350, 2015
|
|
5DS9
| |
5E3O
| |
3RUB
| CRYSTAL STRUCTURE OF THE UNACTIVATED FORM OF RIBULOSE-1,5-BISPHOSPHATE CARBOXYLASE(SLASH)OXYGENASE FROM TOBACCO REFINED AT 2.0-ANGSTROMS RESOLUTION | Descriptor: | ASPARAGINE, RIBULOSE 1,5-BISPHOSPHATE CARBOXYLASE/OXYGENASE, FORM III, ... | Authors: | Schreuder, H, Cascio, D, Curmi, P.M.G, Chapman, M.S, Suh, S.W, Eisenberg, D.S. | Deposit date: | 1990-05-25 | Release date: | 1992-10-15 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Crystal structure of the unactivated form of ribulose-1,5-bisphosphate carboxylase/oxygenase from tobacco refined at 2.0-A resolution. J.Biol.Chem., 267, 1992
|
|
126D
| |
1D30
| THE STRUCTURE OF DAPI BOUND TO DNA | Descriptor: | 6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE, DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3') | Authors: | Larsen, T, Goodsell, D.S, Cascio, D, Grzeskowiak, K, Dickerson, R.E. | Deposit date: | 1991-01-04 | Release date: | 1992-04-15 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The structure of DAPI bound to DNA. J.Biomol.Struct.Dyn., 7, 1989
|
|
3K2R
| Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1 | Descriptor: | CHLORIDE ION, HEXANE-1,6-DIOL, Lysozyme, ... | Authors: | Toledo Warshaviak, D, Cascio, D, Khramtsov, V.V, Hubbell, W.L. | Deposit date: | 2009-09-30 | Release date: | 2010-10-13 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1 To be Published
|
|
5WB4
| Crystal structure of the TarA wall teichoic acid glycosyltransferase | Descriptor: | N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase, SULFATE ION | Authors: | Kattke, M.D, Cascio, D, Sawaya, M.R, Clubb, R.T. | Deposit date: | 2017-06-27 | Release date: | 2019-01-16 | Last modified: | 2019-07-31 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure and mechanism of TagA, a novel membrane-associated glycosyltransferase that produces wall teichoic acids in pathogenic bacteria. Plos Pathog., 15, 2019
|
|
158D
| CRYSTALLOGRAPHIC ANALYSIS OF C-C-A-A-G-C-T-T-G-G AND ITS IMPLICATIONS FOR BENDING IN B-DNA | Descriptor: | CALCIUM ION, DNA (5'-D(*CP*CP*AP*AP*GP*CP*TP*TP*GP*G)-3') | Authors: | Grzeskowiak, K, Goodsell, D.S, Kaczor-Grzeskowiak, M, Cascio, D, Dickerson, R.E. | Deposit date: | 1994-02-03 | Release date: | 1994-05-31 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Crystallographic analysis of C-C-A-A-G-C-T-T-G-G and its implications for bending in B-DNA. Biochemistry, 32, 1993
|
|
1LMI
| 1.5 ANGSTROM RESOLUTION CRYSTAL STRUCTURE OF A SECRETED PROTEIN FROM MYCOBACTERIUM TUBERCULOSIS-MPT63 | Descriptor: | Immunogenic protein MPT63/MPB63 | Authors: | Goulding, C.W, Parseghian, A, Sawaya, M.R, Cascio, D, Apostol, M, Gennaro, M.L, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2002-05-01 | Release date: | 2002-12-04 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Crystal structure of a major secreted protein of Mycobacterium tuberculosis-MPT63 at
1.5-A resolution Protein Sci., 11, 2002
|
|
5WFG
| Crystal structure of the TarA wall teichoic acid glycosyltransferase bound to UDP | Descriptor: | N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase, URIDINE-5'-DIPHOSPHATE | Authors: | Kattke, M.D, Cascio, D, Sawaya, M.R, Clubb, R.T. | Deposit date: | 2017-07-11 | Release date: | 2019-01-16 | Last modified: | 2019-07-31 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure and mechanism of TagA, a novel membrane-associated glycosyltransferase that produces wall teichoic acids in pathogenic bacteria. Plos Pathog., 15, 2019
|
|
3H6P
| Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis | Descriptor: | ESAT-6 LIKE PROTEIN ESXS, ESAT-6-like protein esxR, GLYCEROL | Authors: | Chan, S, Arbing, M, Phan, T, Kaufmann, M, Cascio, D, Eisenberg, D, TB Structural Genomics Consortium (TBSGC), Integrated Center for Structure and Function Innovation (ISFI) | Deposit date: | 2009-04-23 | Release date: | 2009-06-30 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.91 Å) | Cite: | Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis To be Published
|
|
1SLH
| Mycobacterium tuberculosis dUTPase complexed with magnesium and dUDP | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-DIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2004-03-05 | Release date: | 2004-03-16 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism. J.Mol.Biol., 341, 2004
|
|
6BZP
| STGGYG from low-complexity domain of FUS, residues 77-82 | Descriptor: | 2-[2-(2-METHOXY-ETHOXY)-ETHOXY]-ETHOXYL, RNA-binding protein FUS | Authors: | Hughes, M.P, Rodriguez, J.A, Sawaya, M.R, Cascio, D, Gonen, T, Eisenberg, D.S. | Deposit date: | 2017-12-25 | Release date: | 2018-04-04 | Last modified: | 2024-03-13 | Method: | ELECTRON CRYSTALLOGRAPHY (1.1 Å) | Cite: | Atomic structures of low-complexity protein segments reveal kinked beta sheets that assemble networks. Science, 359, 2018
|
|
3JTC
| Importance of Mg2+ in the Ca2+-Dependent Folding of the gamma-Carboxyglutamic Acid Domains of Vitamin K-Dependent clotting and anticlotting Proteins | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, Endothelial protein C receptor, ... | Authors: | Bajaj, S.P, Vadivel, K, Agah, S, Cascio, D, Krishnaswamy, S, Esmon, C, Padmanabhan, K. | Deposit date: | 2009-09-11 | Release date: | 2011-04-06 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structural and Functional Studies of gamma-Carboxyglutamic Acid Domains of Factor VIIa and Activated Protein C: Role of Magnesium at Physiological Calcium. J.Mol.Biol., 425, 2013
|
|
1SM8
| M. tuberculosis dUTPase complexed with chromium and dUTP | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, CHROMIUM ION, DEOXYURIDINE-5'-TRIPHOSPHATE, ... | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2004-03-08 | Release date: | 2004-03-16 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism. J.Mol.Biol., 341, 2004
|
|
6BZM
| GFGNFGTS from low-complexity/FG repeat domain of Nup98, residues 116-123 | Descriptor: | Nuclear pore complex protein Nup98-Nup96 | Authors: | Hughes, M.P, Rodriguez, J.A, Sawaya, M.R, Cascio, D, Chong, L, Gonen, T, Eisenberg, D.S. | Deposit date: | 2017-12-24 | Release date: | 2018-04-04 | Last modified: | 2024-03-13 | Method: | ELECTRON CRYSTALLOGRAPHY (0.9 Å) | Cite: | Atomic structures of low-complexity protein segments reveal kinked beta sheets that assemble networks. Science, 359, 2018
|
|
3H87
| Rv0301 Rv0300 Toxin Antitoxin Complex from Mycobacterium tuberculosis | Descriptor: | BETA-MERCAPTOETHANOL, GLYCEROL, IMIDAZOLE, ... | Authors: | Min, A, Sawaya, M.R, Cascio, D, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI) | Deposit date: | 2009-04-28 | Release date: | 2009-05-05 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.49 Å) | Cite: | The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg(2+) ion in the active site and a putative RNA-binding site. Protein Sci., 21, 2012
|
|
1SQ3
| Crystal structures of a novel open pore ferritin from the hyperthermophilic Archaeon Archaeoglobus fulgidus. | Descriptor: | FE (III) ION, ferritin | Authors: | Johnson, E, Cascio, D, Michael, S, Schroder, I. | Deposit date: | 2004-03-17 | Release date: | 2005-04-12 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of a tetrahedral open pore ferritin from the hyperthermophilic archaeon Archaeoglobus fulgidus. Structure, 13, 2005
|
|
6ARD
| |
6ARC
| |
6BWZ
| SYSGYS from low-complexity domain of FUS, residues 37-42 | Descriptor: | SYSGYS peptide from low-complexity domain of FUS | Authors: | Hughes, M.P, Rodriguez, J.A, Sawaya, M.R, Cascio, D, Tamir, G, Eisenberg, D.S. | Deposit date: | 2017-12-15 | Release date: | 2018-04-04 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.1 Å) | Cite: | Atomic structures of low-complexity protein segments reveal kinked beta sheets that assemble networks. Science, 359, 2018
|
|