4V8P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v8p by Molmil](/molmil-images/mine/4v8p) | T.thermophila 60S ribosomal subunit in complex with initiation factor 6. | Descriptor: | 26S RRNA, 5.8S RRNA, 5S RRNA, ... | Authors: | Klinge, S, Voigts-Hoffmann, F, Leibundgut, M, Arpagaus, S, Ban, N. | Deposit date: | 2011-09-14 | Release date: | 2014-07-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.52 Å) | Cite: | Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6. Science, 334, 2011
|
|
4V5O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v5o by Molmil](/molmil-images/mine/4v5o) | CRYSTAL STRUCTURE OF THE EUKARYOTIC 40S RIBOSOMAL SUBUNIT IN COMPLEX WITH INITIATION FACTOR 1. | Descriptor: | 18S RRNA, 40S RIBOSOMAL PROTEIN S12, 40S RIBOSOMAL PROTEIN S3A, ... | Authors: | Rabl, J, Leibundgut, M, Ataide, S.F, Haag, A, Ban, N. | Deposit date: | 2010-11-26 | Release date: | 2014-07-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.93 Å) | Cite: | Crystal Structure of the Eukaryotic 40S Ribosomal Subunit in Complex with Initiation Factor 1. Science, 331, 2011
|
|
4V58
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v58 by Molmil](/molmil-images/mine/4v58) | Crystal structure of fatty acid synthase from thermomyces lanuginosus at 3.1 angstrom resolution. | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | Deposit date: | 2007-03-09 | Release date: | 2014-07-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling Science, 316, 2007
|
|
4B0S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b0s by Molmil](/molmil-images/mine/4b0s) | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ATP | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DEAMIDASE-DEPUPYLASE DOP, MAGNESIUM ION | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
4B0R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b0r by Molmil](/molmil-images/mine/4b0r) | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway | Descriptor: | DEAMIDASE-DEPUPYLASE DOP | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of Pup ligase PafA and depupylase Dop from the prokaryotic ubiquitin-like modification pathway. Nat Commun, 3, 2012
|
|
4BJR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bjr by Molmil](/molmil-images/mine/4bjr) | Crystal structure of the complex between Prokaryotic Ubiquitin-like Protein Pup and its Ligase PafA | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, PUP--PROTEIN LIGASE, ... | Authors: | Barandun, J, Delley, C.L, Ban, N, Weber-Ban, E. | Deposit date: | 2013-04-19 | Release date: | 2013-05-01 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal Structure of the Complex between Prokaryotic Ubiquitin-Like Protein Pup and its Ligase Pafa. J.Am.Chem.Soc., 135, 2013
|
|
4B0T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b0t by Molmil](/molmil-images/mine/4b0t) | Structure of the Pup Ligase PafA of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, PUP--PROTEIN LIGASE | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.159 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
3MF1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mf1 by Molmil](/molmil-images/mine/3mf1) | Crystal structure of class II aaRS homologue (Bll0957) complexed with an analogue of glycyl adenylate | Descriptor: | 5'-O-(glycylsulfamoyl)adenosine, Bll0957 protein, ZINC ION | Authors: | Weygand-Durasevic, I, Mocibob, M, Ivic, N, Bilokapic, S, Maier, T, Luic, M, Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
8P2K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8p2k by Molmil](/molmil-images/mine/8p2k) | Ternary complex of translating ribosome, NAC and METAP1 | Descriptor: | 18s rRNA, 28S rRNA, 40S ribosomal protein S11, ... | Authors: | Jia, M, Jaskolowski, M, Scaiola, A, Jomaa, A, Ban, N. | Deposit date: | 2023-05-16 | Release date: | 2023-07-19 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | NAC controls cotranslational N-terminal methionine excision in eukaryotes. Science, 380, 2023
|
|
1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
8OIP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oip by Molmil](/molmil-images/mine/8oip) | 28S mammalian mitochondrial small ribosomal subunit with mtRF1 and P-site tRNA | Descriptor: | 12S rRNA, 28S ribosomal protein S15, mitochondrial, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-05-24 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
8OIN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oin by Molmil](/molmil-images/mine/8oin) | 55S mammalian mitochondrial ribosome with mtRF1 and P-site tRNA | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S15, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-06-14 | Last modified: | 2024-06-26 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
8OIQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oiq by Molmil](/molmil-images/mine/8oiq) | 39S mammalian mitochondrial large ribosomal subunit with mtRF1 and P-site tRNA | Descriptor: | 16S rRNA, 39S ribosomal protein L1, mitochondrial, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-06-14 | Last modified: | 2024-06-26 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
5APO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5apo by Molmil](/molmil-images/mine/5apo) | Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and C-terminally tagged Rei1 | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, N. | Deposit date: | 2015-09-17 | Release date: | 2015-12-16 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.41 Å) | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell(Cambridge,Mass.), 164, 2016
|
|
8OIR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oir by Molmil](/molmil-images/mine/8oir) | 55S human mitochondrial ribosome with mtRF1 and P-site tRNA | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S10, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-06-14 | Last modified: | 2024-06-26 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
8OIS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8ois by Molmil](/molmil-images/mine/8ois) | 28S human mitochondrial small ribosomal subunit with mtRF1 and P-site tRNA | Descriptor: | 12S rRNA, 28S ribosomal protein S10, mitochondrial, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-06-14 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
8OIT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8oit by Molmil](/molmil-images/mine/8oit) | 39S human mitochondrial large ribosomal subunit with mtRF1 and P-site tRNA | Descriptor: | 16S rRNA, 39S ribosomal protein L1, mitochondrial, ... | Authors: | Saurer, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Ban, N. | Deposit date: | 2023-03-23 | Release date: | 2023-06-14 | Last modified: | 2024-06-26 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Molecular basis of translation termination at noncanonical stop codons in human mitochondria. Science, 380, 2023
|
|
5AJ4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5aj4 by Molmil](/molmil-images/mine/5aj4) | Structure of the 55S mammalian mitoribosome. | Descriptor: | 28S RIBOSOMAL PROTEIN S18B, MITOCHONDRIAL, GUANOSINE-5'-DIPHOSPHATE, ... | Authors: | Greber, B.J, Bieri, P, Leibundgut, M, Leitner, A, Aebersold, R, Boehringer, D, Ban, N. | Deposit date: | 2015-02-20 | Release date: | 2015-04-22 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | The complete structure of the 55S mammalian mitochondrial ribosome. Science, 348, 2015
|
|
1FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
7PUA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pua by Molmil](/molmil-images/mine/7pua) | Middle assembly intermediate of the Trypanosoma brucei mitoribosomal small subunit | Descriptor: | 30S Ribosomal protein S17, putative, 30S ribosomal protein S8, ... | Authors: | Lenarcic, T, Leibundgut, M, Saurer, M, Ramrath, D.J.F, Fluegel, T, Boehringer, D, Ban, N. | Deposit date: | 2021-09-29 | Release date: | 2022-03-02 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Mitoribosomal small subunit maturation involves formation of initiation-like complexes. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
7PUB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pub by Molmil](/molmil-images/mine/7pub) | Late assembly intermediate of the Trypanosoma brucei mitoribosomal small subunit | Descriptor: | 30S Ribosomal protein S17, putative, 30S ribosomal protein S8, ... | Authors: | Lenarcic, T, Leibundgut, M, Saurer, M, Ramrath, D.J.F, Fluegel, T, Boehringer, D, Ban, N. | Deposit date: | 2021-09-29 | Release date: | 2022-05-04 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Mitoribosomal small subunit maturation involves formation of initiation-like complexes. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
7QWS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7qws by Molmil](/molmil-images/mine/7qws) | Structure of ribosome translating beta-tubulin in complex with TTC5 and NAC | Descriptor: | 28S rRNA, 5.8S rRNA, 5S rRNA, ... | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | Deposit date: | 2022-01-25 | Release date: | 2022-03-09 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting. Science, 375, 2022
|
|
7QWR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7qwr by Molmil](/molmil-images/mine/7qwr) | Structure of the ribosome-nascent chain containing an ER signal sequence in complex with NAC | Descriptor: | 28S rRNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | Deposit date: | 2022-01-25 | Release date: | 2022-03-09 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting. Science, 375, 2022
|
|
7QWQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7qwq by Molmil](/molmil-images/mine/7qwq) | Ternary complex of ribosome nascent chain with SRP and NAC | Descriptor: | 28S rRNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | Deposit date: | 2022-01-25 | Release date: | 2022-03-16 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (2.83 Å) | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting. Science, 375, 2022
|
|
6SGB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6sgb by Molmil](/molmil-images/mine/6sgb) | mt-SSU assemblosome of Trypanosoma brucei | Descriptor: | 9S rRNA, GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Saurer, M, Ramrath, D.J.F, Niemann, M, Calderaro, S, Prange, C, Mattei, S, Scaiola, A, Leitner, A, Bieri, P, Horn, E.K, Leibundgut, M, Boehringer, D, Schneider, A, Ban, N. | Deposit date: | 2019-08-03 | Release date: | 2019-09-25 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Mitoribosomal small subunit biogenesis in trypanosomes involves an extensive assembly machinery. Science, 365, 2019
|
|