1KRP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1krp by Molmil](/molmil-images/mine/1krp) | DNA polymerase I Klenow fragment (E.C.2.7.7.7) mutant/DNA complex | Descriptor: | DNA (5'-D(P*TP*TP*PST)-3'), PROTEIN (DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7)), ZINC ION | Authors: | Brautigam, C.A, Steitz, T.A. | Deposit date: | 1997-08-19 | Release date: | 1998-02-25 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structural principles for the inhibition of the 3'-5' exonuclease activity of Escherichia coli DNA polymerase I by phosphorothioates. J.Mol.Biol., 277, 1998
|
|
1KSB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ksb by Molmil](/molmil-images/mine/1ksb) | Relationship of Solution and Protein-Bound Structures of DNA Duplexes with the Major Intrastrand Cross-Link Lesions Formed on Cisplatin Binding to DNA | Descriptor: | 5'-D(*AP*GP*GP*CP*CP*GP*GP*AP*G)-3', 5'-D(*CP*TP*CP*CP*GP*GP*CP*CP*T)-3', Cisplatin | Authors: | Marzilli, L.G, Saad, J.S, Kuklenyik, Z, Keating, K.A, Xu, Y. | Deposit date: | 2002-01-11 | Release date: | 2002-01-17 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Relationship of solution and protein-bound structures of DNA duplexes with the major intrastrand cross-link lesions formed on cisplatin binding to DNA. J.Am.Chem.Soc., 123, 2001
|
|
1KX0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx0 by Molmil](/molmil-images/mine/1kx0) | Rat mannose protein A (H189V I207V) complexed with man-a13-man | Descriptor: | CALCIUM ION, CHLORIDE ION, MANNOSE-BINDING PROTEIN A, ... | Authors: | Ng, K.K, Kolatkar, A.R, Park-Snyder, S, Feinberg, H, Clark, D.A, Drickamer, K, Weis, W.I. | Deposit date: | 2002-01-30 | Release date: | 2002-07-05 | Last modified: | 2021-10-27 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Orientation of bound ligands in mannose-binding proteins. Implications for multivalent ligand recognition. J.Biol.Chem., 277, 2002
|
|
7S9U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7s9u by Molmil](/molmil-images/mine/7s9u) | 44SR3C ribosomal particle | Descriptor: | 50S ribosomal protein L13, 50S ribosomal protein L14, 50S ribosomal protein L15, ... | Authors: | Ortega, J, Seffouh, A. | Deposit date: | 2021-09-21 | Release date: | 2022-03-02 | Last modified: | 2022-11-16 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | RbgA ensures the correct timing in the maturation of the 50S subunits functional sites. Nucleic Acids Res., 50, 2022
|
|
5XRA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xra by Molmil](/molmil-images/mine/5xra) | Crystal structure of the human CB1 in complex with agonist AM11542 | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (6aR,10aR)-3-(8-bromanyl-2-methyl-octan-2-yl)-6,6,9-trimethyl-6a,7,10,10a-tetrahydrobenzo[c]chromen-1-ol, CHOLESTEROL, ... | Authors: | Hua, T, Vemuri, K, Nikas, P.S, Laprairie, R.B, Wu, Y, Qu, L, Pu, M, Korde, A, Shan, J, Ho, J.H, Han, G.W, Ding, K, Li, X, Liu, H, Hanson, M.A, Zhao, S, Bohn, L.M, Makriyannis, A, Stevens, R.C, Liu, Z.J. | Deposit date: | 2017-06-08 | Release date: | 2017-07-12 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of agonist-bound human cannabinoid receptor CB1 Nature, 547, 2017
|
|
7SAE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7sae by Molmil](/molmil-images/mine/7sae) | 44SR70P Class1 ribosomal particle | Descriptor: | 50S ribosomal protein L13, 50S ribosomal protein L14, 50S ribosomal protein L15, ... | Authors: | Ortega, J, Seffouh, A. | Deposit date: | 2021-09-22 | Release date: | 2022-03-02 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | RbgA ensures the correct timing in the maturation of the 50S subunits functional sites. Nucleic Acids Res., 50, 2022
|
|
1KV7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kv7 by Molmil](/molmil-images/mine/1kv7) | Crystal Structure of CueO, a multi-copper oxidase from E. coli involved in copper homeostasis | Descriptor: | COPPER (II) ION, CU-O-CU LINKAGE, PROBABLE BLUE-COPPER PROTEIN YACK | Authors: | Roberts, S.A, Weichsel, A, Grass, G, Thakali, K, Hazzard, J.T, Tollin, G, Rensing, C, Montfort, W.R. | Deposit date: | 2002-01-25 | Release date: | 2002-02-06 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Crystal structure and electron transfer kinetics of CueO, a multicopper oxidase required for copper homeostasis in Escherichia coli. Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1KUK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kuk by Molmil](/molmil-images/mine/1kuk) | Crystal Structure of a Taiwan Habu Venom Metalloproteinase complexed with pEKW. | Descriptor: | CADMIUM ION, EKW, metalloproteinase | Authors: | Huang, K.F, Chiou, S.H, Ko, T.P, Wang, A.H.J. | Deposit date: | 2002-01-22 | Release date: | 2002-07-10 | Last modified: | 2019-12-25 | Method: | X-RAY DIFFRACTION (1.45 Å) | Cite: | Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues. Eur.J.Biochem., 269, 2002
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KUG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kug by Molmil](/molmil-images/mine/1kug) | Crystal Structure of a Taiwan Habu Venom Metalloproteinase complexed with its endogenous inhibitor pENW | Descriptor: | CADMIUM ION, ENW, metalloproteinase | Authors: | Huang, K.F, Chiou, S.H, Ko, T.P, Wang, A.H.J. | Deposit date: | 2002-01-22 | Release date: | 2002-07-10 | Last modified: | 2019-12-25 | Method: | X-RAY DIFFRACTION (1.37 Å) | Cite: | Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues. Eur.J.Biochem., 269, 2002
|
|
1KWZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kwz by Molmil](/molmil-images/mine/1kwz) | Rat mannose protein A (H189V) complexed with Man-a13-Man | Descriptor: | CALCIUM ION, CHLORIDE ION, MANNOSE-BINDING PROTEIN A, ... | Authors: | Ng, K.K, Kolatkar, A.R, Park-Snyder, S, Feinberg, H, Clark, D.A, Drickamer, K, Weis, W.I. | Deposit date: | 2002-01-30 | Release date: | 2002-07-05 | Last modified: | 2021-10-27 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Orientation of bound ligands in mannose-binding proteins. Implications for multivalent ligand recognition. J.Biol.Chem., 277, 2002
|
|
1KWV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kwv by Molmil](/molmil-images/mine/1kwv) | Rat mannose binding protein A complexed with a-Me-GlcNAc | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, CHLORIDE ION, ... | Authors: | Ng, K.K, Kolatkar, A.R, Park-Snyder, S, Feinberg, H, Clark, D.A, Drickamer, K, Weis, W.I. | Deposit date: | 2002-01-30 | Release date: | 2002-07-05 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Orientation of bound ligands in mannose-binding proteins. Implications for multivalent ligand recognition. J.Biol.Chem., 277, 2002
|
|
6O5Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6o5y by Molmil](/molmil-images/mine/6o5y) | Structure of Human Cytochrome P450 1A1 with 5-amino-N-(5-((4R,5R)-4-amino-5-fluoroazepan-1-yl)-1-methyl-1H-pyrazol-4-yl)-2-(2,6-difluorophenyl)thiazole-4-carboxamide) | Descriptor: | 5-amino-N-{5-[(4R,5R)-4-amino-5-fluoroazepan-1-yl]-1-methyl-1H-pyrazol-4-yl}-2-(2,6-difluorophenyl)-1,3-thiazole-4-carboxamide, Cytochrome P450 1A1, NITRATE ION, ... | Authors: | Bart, A.G, Scott, E.E. | Deposit date: | 2019-03-04 | Release date: | 2019-12-04 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.17 Å) | Cite: | Human Cytochrome P450 1A1 Adapts Active Site for Atypical Nonplanar Substrate. Drug Metab.Dispos., 48, 2020
|
|
7NBJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nbj by Molmil](/molmil-images/mine/7nbj) | |
7NBQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nbq by Molmil](/molmil-images/mine/7nbq) | Co-crystal structure of Human Nicotinamide N-methyltransferase (NNMT) with the tricyclic inhibitor (4) | Descriptor: | 2-methyl-1,2,6,7-tetrahydro-3H,5H-pyrido[3,2,1-ij]quinazolin-3-imine, Nicotinamide N-methyltransferase, S-ADENOSYL-L-HOMOCYSTEINE | Authors: | Schreuder, H.A, Liesum, A. | Deposit date: | 2021-01-27 | Release date: | 2021-03-17 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.479 Å) | Cite: | Novel Inhibitors of Nicotinamide- N -Methyltransferase for the Treatment of Metabolic Disorders. Molecules, 26, 2021
|
|
7NIO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nio by Molmil](/molmil-images/mine/7nio) | Crystal structure of the SARS-CoV-2 helicase APO form | Descriptor: | SARS-CoV-2 helicase NSP13, ZINC ION | Authors: | Newman, J.A, Yosaatmadja, Y, Douangamath, A, Bountra, C, Gileadi, O. | Deposit date: | 2021-02-12 | Release date: | 2021-03-17 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structure, mechanism and crystallographic fragment screening of the SARS-CoV-2 NSP13 helicase. Nat Commun, 12, 2021
|
|
1KGC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kgc by Molmil](/molmil-images/mine/1kgc) | Immune Receptor | Descriptor: | T-cell receptor alpha chain, T-cell receptor beta chain | Authors: | Kjer-Nielsen, L, Clements, C.S, Brooks, A.G, Purcell, A.W, McCluskey, J, Rossjohn, J. | Deposit date: | 2001-11-26 | Release date: | 2002-12-11 | Last modified: | 2022-12-21 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | The 1.5 A crystal structure of a highly selected antiviral T cell receptor provides evidence for a structural basis of immunodominance STRUCTURE, 10, 2002
|
|
7NLJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nlj by Molmil](/molmil-images/mine/7nlj) | |
7NN0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7nn0 by Molmil](/molmil-images/mine/7nn0) | Crystal structure of the SARS-CoV-2 helicase in complex with AMP-PNP | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, SARS-CoV-2 helicase NSP13, ... | Authors: | Newman, J.A, Yosaatmadja, Y, Douangamath, A, Bountra, C, Gileadi, O. | Deposit date: | 2021-02-23 | Release date: | 2021-03-24 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (3.04 Å) | Cite: | Structure, mechanism and crystallographic fragment screening of the SARS-CoV-2 NSP13 helicase. Nat Commun, 12, 2021
|
|
2P49
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p49 by Molmil](/molmil-images/mine/2p49) | Complex of a camelid single-domain vhh antibody fragment with RNASE A at 1.4A resolution: native mono_1 crystal form | Descriptor: | ANTIBODY CAB-RN05, PHOSPHATE ION, Ribonuclease pancreatic | Authors: | Tereshko, V, Uysal, S, Margalef, K, Koide, A, Kossiakoff, A.A, Koide, S. | Deposit date: | 2007-03-11 | Release date: | 2007-08-28 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.38 Å) | Cite: | Exploring the capacity of minimalist protein interfaces: interface energetics and affinity maturation to picomolar KD of a single-domain antibody with a flat paratope. J.Mol.Biol., 373, 2007
|
|
7NGC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ngc by Molmil](/molmil-images/mine/7ngc) | P2a-state of wild type human mitochondrial LONP1 protease with bound substrate protein and in presence of ATPgS | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Lon protease homolog, mitochondrial, ... | Authors: | Mohammed, I, Schmitz, K.A, Schenck, N, Maier, T, Abrahams, J.P. | Deposit date: | 2021-02-09 | Release date: | 2021-04-07 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (7.5 Å) | Cite: | Catalytic cycling of human mitochondrial Lon protease. Structure, 30, 2022
|
|
5IQO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5iqo by Molmil](/molmil-images/mine/5iqo) | Crystal structure of the E. coli type 1 pilus subunit FimG (engineered variant with substitutions Q134E and S138E; N-terminal FimG residues 1-12 truncated) in complex with the donor strand peptide DsF_T4R-T6R-D13N | Descriptor: | 1,2-ETHANEDIOL, COBALT (II) ION, PENTAETHYLENE GLYCOL, ... | Authors: | Giese, C, Eras, J, Kern, A, Capitani, G, Glockshuber, R. | Deposit date: | 2016-03-11 | Release date: | 2016-07-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.302 Å) | Cite: | Accelerating the Association of the Most Stable Protein-Ligand Complex by More than Two Orders of Magnitude. Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
1KMO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kmo by Molmil](/molmil-images/mine/1kmo) | Crystal structure of the Outer Membrane Transporter FecA | Descriptor: | HEPTANE-1,2,3-TRIOL, Iron(III) dicitrate transport protein fecA, LAURYL DIMETHYLAMINE-N-OXIDE | Authors: | Ferguson, A.D, Chakraborty, R, Smith, B.S, Esser, L, van der Helm, D, Deisenhofer, J. | Deposit date: | 2001-12-17 | Release date: | 2002-03-06 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural basis of gating by the outer membrane transporter FecA. Science, 295, 2002
|
|
1KMP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kmp by Molmil](/molmil-images/mine/1kmp) | Crystal structure of the Outer Membrane Transporter FecA Complexed with Ferric Citrate | Descriptor: | CITRIC ACID, FE (III) ION, IRON(III) DICITRATE TRANSPORT PROTEIN FECA, ... | Authors: | Ferguson, A.D, Chakraborty, R, Smith, B.S, Esser, L, van der Helm, D, Deisenhofer, J. | Deposit date: | 2001-12-17 | Release date: | 2002-03-06 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structural basis of gating by the outer membrane transporter FecA. Science, 295, 2002
|
|