8DR9
| |
8J0I
| Aldo-keto reductase KmAKR | Descriptor: | NADPH-dependent alpha-keto amide reductase, SODIUM ION | Authors: | Xu, S.Y, Zhou, L, Xu, Y, Wang, Y.J, Zheng, Y.G. | Deposit date: | 2023-04-11 | Release date: | 2024-04-17 | Method: | X-RAY DIFFRACTION (1.91 Å) | Cite: | Aldo-keto reductase KmAKR from Kluyveromyces marxianus To Be Published
|
|
8IKU
| |
8WSQ
| |
2B5A
| C.BclI, Control Element of the BclI Restriction-Modification System | Descriptor: | ACETIC ACID, C.BclI | Authors: | Sawaya, M.R, Zhu, Z, Mersha, F, Chan, S.H, Dabur, R, Xu, S.Y, Balendiran, G.K. | Deposit date: | 2005-09-28 | Release date: | 2006-01-03 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.543 Å) | Cite: | Crystal Structure of the Restriction-Modification System Control Element C.BclI and Mapping of Its Binding Site. Structure, 13, 2005
|
|
4ZCF
| Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|
1SDO
| Crystal Structure of Restriction Endonuclease BstYI | Descriptor: | BstYI | Authors: | Townson, S.A, Samuelson, J.C, Vanamee, E.S, Edwards, T.A, Escalante, C.R, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2004-02-13 | Release date: | 2004-05-11 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | Crystal Structure of BstYI at 1.85 A Resolution: A Thermophilic Restriction Endonuclease with Overlapping Specificities to BamHI and BglII J.Mol.Biol., 338, 2004
|
|
1VRR
| Crystal structure of the restriction endonuclease BstYI complex with DNA | Descriptor: | 5'-D(*TP*TP*AP*TP*AP*GP*AP*TP*CP*TP*AP*TP*AP*A)-3', BstYI | Authors: | Townson, S.A, Samuelson, J.C, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2005-06-02 | Release date: | 2005-06-07 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Implications for Switching Restriction Enzyme Specificities from the Structure of BstYI Bound to a BglII DNA Sequence. Structure, 13, 2005
|
|
2P0J
| Structure of restriction endonuclease BstYI bound to non-cognate DNA | Descriptor: | 5'-D(*AP*TP*GP*AP*AP*TP*CP*CP*AP*TP*A)-3', 5'-D(*TP*AP*TP*GP*GP*AP*TP*TP*CP*AP*T)-3', BstYI | Authors: | Townson, S.A, Samuelson, J.C, Bao, Y, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2007-02-28 | Release date: | 2007-05-01 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | BstYI Bound to Noncognate DNA Reveals a "Hemispecific" Complex: Implications for DNA Scanning. Structure, 15, 2007
|
|
3S1S
| Characterization and crystal structure of the type IIG restriction endonuclease BpuSI | Descriptor: | 1,2-ETHANEDIOL, IODIDE ION, MANGANESE (II) ION, ... | Authors: | Shen, B.W, Xu, D, Chan, S.-H, Zheng, Y, Zhu, Y, Xu, S.-Y, Stoddard, B.L. | Deposit date: | 2011-05-16 | Release date: | 2011-07-13 | Last modified: | 2011-10-19 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Characterization and crystal structure of the type IIG restriction endonuclease RM.BpuSI. Nucleic Acids Res., 39, 2011
|
|
6YEX
| VcaM4I restriction endonuclease in the absence of DNA | Descriptor: | CHLORIDE ION, HNH endonuclease, SULFATE ION | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | Deposit date: | 2020-03-25 | Release date: | 2020-12-16 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA. Nucleic Acids Res., 49, 2021
|
|
6YMG
| VcaM4I restriction endonuclease in complex with 5mC-modified dsDNA | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*CP*AP*TP*GP*(5CM)P*GP*CP*TP*GP*A)-3'), DNA (5'-D(P*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)-3'), ... | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | Deposit date: | 2020-04-08 | Release date: | 2020-12-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3.14 Å) | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA. Nucleic Acids Res., 49, 2021
|
|
6YJB
| VcaM4I restriction endonuclease 5hmC-ssDNA complex | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*AP*(5HC)P*AP*G)-3'), GLYCEROL, ... | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | Deposit date: | 2020-04-02 | Release date: | 2020-12-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA. Nucleic Acids Res., 49, 2021
|
|
6YKF
| VcaM4I restriction endonuclease in the presence of 5mC-modified ssDNA | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*AP*(5CM)P*AP*G)-3'), GLYCEROL, ... | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | Deposit date: | 2020-04-06 | Release date: | 2020-12-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.48 Å) | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA. Nucleic Acids Res., 49, 2021
|
|
6GHC
| Modification dependent EcoKMcrA restriction endonuclease | Descriptor: | 5-methylcytosine-specific restriction enzyme A, ZINC ION | Authors: | Czapinska, H, Kowalska, M, Zagorskaite, E, Manakova, E, Xu, S, Siksnys, V, Sasnauskas, G, Bochtler, M. | Deposit date: | 2018-05-07 | Release date: | 2018-08-08 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Activity and structure of EcoKMcrA. Nucleic Acids Res., 46, 2018
|
|
6GHS
| Modification dependent TagI restriction endonuclease | Descriptor: | SODIUM ION, TagI restriction endonuclease, ZINC ION | Authors: | Kisiala, M, Copelas, A, Czapinska, H, Xu, S, Bochtler, M. | Deposit date: | 2018-05-08 | Release date: | 2018-08-29 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.92 Å) | Cite: | Crystal structure of the modification-dependent SRA-HNH endonuclease TagI. Nucleic Acids Res., 46, 2018
|
|
3LDY
| An extraordinary mechanism of DNA perturbation exhibited by the rare-cutting HNH restriction endonuclease PacI | Descriptor: | CALCIUM ION, DNA (5'-D(*GP*AP*GP*GP*CP*TP*TP*A)-3'), DNA (5'-D(P*AP*TP*TP*AP*AP*GP*CP*CP*TP*C)-3'), ... | Authors: | Shen, B.W, Heiter, D, Chan, S.-H, Xu, S.-Y, Wilson, G, Stoddard, B.L. | Deposit date: | 2010-01-13 | Release date: | 2010-04-21 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI. Structure, 18, 2010
|
|
3M7K
| Crystal structure of PacI-DNA Enzyme product complex | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*GP*AP*GP*GP*CP*TP*TP*AP*AP*T)-3'), DNA (5'-D(P*TP*AP*AP*GP*CP*CP*TP*C)-3'), ... | Authors: | Shen, B.W, Stoddard, B.L. | Deposit date: | 2010-03-16 | Release date: | 2010-04-21 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.92 Å) | Cite: | Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI. Structure, 18, 2010
|
|
8RPX
| NhoI restriction endonuclease in complex with quadruply methylated DNA target | Descriptor: | 1,2-ETHANEDIOL, CALCIUM ION, DNA (5'-D(*CP*TP*GP*(5CM)P*AP*GP*(5CM)P*TP*C)-3'), ... | Authors: | Rafalski, D, Krakowska, K, Gilski, M, Bochtler, M. | Deposit date: | 2024-01-17 | Release date: | 2024-07-17 | Last modified: | 2024-09-04 | Method: | X-RAY DIFFRACTION (1.81 Å) | Cite: | Structural analysis of the BisI family of modification dependent restriction endonucleases. Nucleic Acids Res., 52, 2024
|
|
6R64
| N-terminal domain of modification dependent EcoKMcrA restriction endonuclease (NEco) in complex with C5mCGG target sequence | Descriptor: | 5-methylcytosine-specific restriction enzyme A, DNA (5'-D(*GP*AP*AP*CP*(5CM)P*GP*GP*TP*GP*A)-3'), DNA (5'-D(*TP*CP*AP*CP*(5CM)P*GP*GP*TP*TP*C)-3') | Authors: | Slyvka, A, Zagorskaite, E, Czapinska, H, Sasnauskas, G, Bochtler, M. | Deposit date: | 2019-03-26 | Release date: | 2019-10-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.64 Å) | Cite: | Crystal structure of the EcoKMcrA N-terminal domain (NEco): recognition of modified cytosine bases without flipping. Nucleic Acids Res., 47, 2019
|
|
3BVQ
| Crystal Structure of Apo NotI Restriction Endonuclease | Descriptor: | FE (III) ION, NotI restriction endonuclease, SULFATE ION | Authors: | Lambert, A.R, Sussman, D, Shen, B, Stoddard, B.L. | Deposit date: | 2008-01-07 | Release date: | 2008-01-22 | Last modified: | 2017-10-25 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structures of the Rare-Cutting Restriction Endonuclease NotI Reveal a Unique Metal Binding Fold Involved in DNA Binding. Structure, 16, 2008
|
|
3C25
| Crystal Structure of NotI Restriction Endonuclease Bound to Cognate DNA | Descriptor: | CALCIUM ION, DNA (5'-D(*DCP*DGP*DGP*DAP*DGP*DGP*DCP*DGP*DCP*DGP*DGP*DCP*DCP*DGP*DCP*DGP*DCP*DCP*DGP*DCP*DCP*DG)-3'), DNA (5'-D(*DCP*DGP*DGP*DCP*DGP*DGP*DCP*DGP*DCP*DGP*DGP*DCP*DCP*DGP*DCP*DGP*DCP*DCP*DTP*DCP*DCP*DG)-3'), ... | Authors: | Lambert, A.R, Sussman, D, Shen, B, Stoddard, B.L. | Deposit date: | 2008-01-24 | Release date: | 2008-02-12 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structures of the Rare-Cutting Restriction Endonuclease NotI Reveal a Unique Metal Binding Fold Involved in DNA Binding. Structure, 16, 2008
|
|
3BM3
| Restriction endonuclease PspGI-substrate DNA complex | Descriptor: | CITRIC ACID, DNA (5'-D(*CP*AP*TP*CP*CP*AP*GP*GP*TP*AP*C)-3'), DNA (5'-D(*GP*GP*TP*AP*CP*CP*TP*GP*GP*AP*T)-3'), ... | Authors: | Szczepanowski, R.H, Carpenter, M, Czapinska, H, Tamulaitis, G, Siksnys, V, Bhagwat, A, Bochtler, M. | Deposit date: | 2007-12-12 | Release date: | 2008-09-16 | Last modified: | 2021-10-20 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | A direct crystallographic demonstration that Type II restriction endonuclease PspGI flips nucleotides To be Published
|
|
5DWA
| Crystal structure of pre-specific restriction endonuclease AgeI-DNA complex | Descriptor: | DNA (5'-D(*TP*CP*GP*AP*CP*CP*GP*GP*TP*CP*G*)-3'), Type-2 restriction enzyme AgeI | Authors: | Tamulaitiene, G, Jovaisaite, V, Grazulis, S, Siksnys, V. | Deposit date: | 2015-09-22 | Release date: | 2016-10-05 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Restriction endonuclease AgeI is a monomer which dimerizes to cleave DNA. Nucleic Acids Res., 45, 2017
|
|
5DWC
| |