7PVK
| X-ray structure of dimeric PorX (T272A mutant), in complex with pGpG. | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FORMIC ACID, GLYCEROL, ... | Authors: | Schmitz, C.A, Madej, M, Potempa, J, Sola, M. | Deposit date: | 2021-10-04 | Release date: | 2022-12-14 | Last modified: | 2023-01-11 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Response regulator PorX coordinates oligonucleotide signalling and gene expression to control the secretion of virulence factors Nucleic Acids Res., 50, 2022
|
|
7PVA
| 1.9 Angstrom crystal structure of dimeric PorX, co-crystallized in the presence of zinc | Descriptor: | BERYLLIUM TRIFLUORIDE ION, CHLORIDE ION, FORMIC ACID, ... | Authors: | Schmitz, C.A, Madej, M, Potempa, J, Sola, M. | Deposit date: | 2021-10-01 | Release date: | 2022-12-14 | Last modified: | 2022-12-28 | Method: | X-RAY DIFFRACTION (1.91 Å) | Cite: | Response regulator PorX coordinates oligonucleotide signalling and gene expression to control the secretion of virulence factors. Nucleic Acids Res., 50, 2022
|
|
5CX8
| Structure of RagB, a major immunodominant virulence factor of Porphyromonas gingivalis. | Descriptor: | 3-deoxy-5-O-phosphono-beta-D-ribofuranose, 3-deoxy-beta-D-glucopyranose, 6-O-phosphono-D-tagatose, ... | Authors: | Goulas, T, Garcia-Ferrer, I, Hutcherson, J.A, Potempa, B.A, Potempa, J, Scott, D.A, Gomis-Ruth, F.X. | Deposit date: | 2015-07-28 | Release date: | 2015-10-21 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of RagB, a major immunodominant outer-membrane surface receptor antigen of Porphyromonas gingivalis. Mol Oral Microbiol, 31, 2016
|
|
6ZA2
| Crystal structure of dimeric latent PorU from Porphyromonas gingivalis | Descriptor: | CALCIUM ION, Por secretion system protein porU | Authors: | Gomis-Ruth, F.X, Goulas, T, Guevara, T, Rodriguez-Banqueri, A, Potempa, J. | Deposit date: | 2020-06-04 | Release date: | 2021-09-29 | Last modified: | 2021-10-13 | Method: | X-RAY DIFFRACTION (3.35 Å) | Cite: | Intermolecular latency regulates the essential C-terminal signal peptidase and sortase of the Porphyromonas gingivalis type-IX secretion system. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
1X9Y
| The prostaphopain B structure | Descriptor: | cysteine proteinase | Authors: | Filipek, R, Szczepanowski, R, Sabat, A, Potempa, J, Bochtler, M. | Deposit date: | 2004-08-24 | Release date: | 2004-11-23 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Prostaphopain B structure: a comparison of proregion-mediated and staphostatin-mediated protease inhibition. Biochemistry, 43, 2004
|
|
1OH1
| Solution structure of staphostatin A form Staphylococcus aureus confirms the discovery of a novel class of cysteine proteinase inhibitors. | Descriptor: | STAPHOSTATIN A | Authors: | Dubin, G, Popowicz, G, Krajewski, M, Stec, J, Bochtler, M, Potempa, J, Dubin, A, Holak, T.A. | Deposit date: | 2003-05-21 | Release date: | 2003-11-20 | Last modified: | 2011-07-13 | Method: | SOLUTION NMR | Cite: | A Novel Class of Cysteine Protease Inhibitors: Solution Structure of Staphostatin a from Staphylococcus Aureus Biochemistry, 42, 2003
|
|
1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
2AS9
| Functional and structural characterization of Spl proteases from staphylococcus aureus | Descriptor: | ZINC ION, serine protease | Authors: | Popowicz, G.M, Dubin, G, Stec-Niemczyk, J, Czarny, A, Dubin, A, Potempa, J, Holak, T.A. | Deposit date: | 2005-08-23 | Release date: | 2005-09-06 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Functional and Structural Characterization of Spl Proteases from Staphylococcus aureus J.Mol.Biol., 358, 2006
|
|
4IEF
| Complex of Porphyromonas gingivalis RgpB pro- and mature domains | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, BARIUM ION, CALCIUM ION, ... | Authors: | de Diego, I, Veillard, F.T, Guevara, T, Potempa, B, Sztukowska, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2012-12-13 | Release date: | 2013-04-10 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Porphyromonas gingivalis Virulence Factor Gingipain RgpB Shows a Unique Zymogenic Mechanism for Cysteine Peptidases. J.Biol.Chem., 288, 2013
|
|
1BQB
| AUREOLYSIN, STAPHYLOCOCCUS AUREUS METALLOPROTEINASE | Descriptor: | CALCIUM ION, PROTEIN (AUREOLYSIN), ZINC ION | Authors: | Medrano, F.J, Banbula, A, Potempa, J, Travis, J, Bode, W. | Deposit date: | 1998-07-14 | Release date: | 1999-01-13 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (1.72 Å) | Cite: | Amino-acid sequence and three-dimensional structure of the Staphylococcus aureus metalloproteinase at 1.72 A resolution. Structure, 6, 1998
|
|
6R7U
| Selenomethionine variant of Tannerella forsythia promirolysin mutant E225A | Descriptor: | BORIC ACID, CALCIUM ION, GLYCEROL, ... | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2019-03-29 | Release date: | 2020-02-05 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases. Iucrj, 7, 2020
|
|
6R7V
| Tannerella forsythia promirolysin mutant E225A | Descriptor: | CALCIUM ION, GLYCEROL, Mirolysin, ... | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2019-03-29 | Release date: | 2019-11-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases. Iucrj, 7, 2020
|
|
6R7W
| Tannerella forsythia mature mirolysin in complex with a cleaved peptide. | Descriptor: | CALCIUM ION, CITRIC ACID, ETHANOL, ... | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2019-03-29 | Release date: | 2019-11-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases. Iucrj, 7, 2020
|
|
1NYC
| Staphostatins resemble lipocalins, not cystatins in fold. | Descriptor: | CHLORIDE ION, SULFATE ION, cysteine protease inhibitor | Authors: | Rzychon, M, Filipek, R, Sabat, A, Kosowska, K, Dubin, A, Potempa, J, Bochtler, M. | Deposit date: | 2003-02-12 | Release date: | 2003-09-30 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Staphostatins resemble lipocalins, not cystatins in fold. Protein Sci., 12, 2003
|
|
6QQL
| Crystal structure of Porphyromonas gingivalis glutaminyl cyclase | Descriptor: | Glutamine cyclotransferase, ZINC ION | Authors: | Linnert, M, Piechotta, A, Parthier, C, Taudte, N, Kolenko, P, Rahfeld, J, Potempa, J, Stubbs, M.T. | Deposit date: | 2019-02-18 | Release date: | 2019-03-06 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.814 Å) | Cite: | Mammalian-like type II glutaminyl cyclases in Porphyromonas gingivalis and other oral pathogenic bacteria as targets for treatment of periodontitis. J.Biol.Chem., 296, 2021
|
|
6QRO
| Crystal structure of Tannerella forsythia glutaminyl cyclase | Descriptor: | Glutamine cyclotransferase, SULFATE ION, ZINC ION | Authors: | Linnert, M, Piechotta, A, Parthier, C, Taudte, N, Kolenko, P, Rahfeld, J, Potempa, J, Stubbs, M.T. | Deposit date: | 2019-02-19 | Release date: | 2019-03-06 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Mammalian-like type II glutaminyl cyclases in Porphyromonas gingivalis and other oral pathogenic bacteria as targets for treatment of periodontitis. J.Biol.Chem., 296, 2021
|
|
3BB7
| Structure of Prevotella intermedia prointerpain A fragment 39-359 (mutant C154A) | Descriptor: | interpain A | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2007-11-09 | Release date: | 2007-11-20 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A J.Biol.Chem., 283, 2008
|
|
4R3V
| Structure of karilysin propeptide and catalytic MMP domain | Descriptor: | CALCIUM ION, GLYCEROL, Karilysin, ... | Authors: | Lopez-Pelegrin, M, Ksiazek, M, Karim, A.Y, Guevara, T, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2014-08-18 | Release date: | 2015-01-07 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.01 Å) | Cite: | A novel mechanism of latency in matrix metalloproteinases. J.Biol.Chem., 290, 2015
|
|
3BBA
| Structure of active wild-type Prevotella intermedia interpain A cysteine protease | Descriptor: | interpain A | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2007-11-09 | Release date: | 2007-11-20 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A J.Biol.Chem., 283, 2008
|
|
1AU8
| HUMAN CATHEPSIN G | Descriptor: | CATHEPSIN G, N-(3-carboxypropanoyl)-L-valyl-N-[(1R)-5-amino-1-phosphonopentyl]-L-prolinamide | Authors: | Medrano, F.J, Bode, W, Banbula, A, Potempa, J. | Deposit date: | 1997-09-12 | Release date: | 1998-10-14 | Last modified: | 2012-12-12 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | HUMAN CATHEPSIN G to be published
|
|
4IN9
| Structure of karilysin MMP-like catalytic domain in complex with inhibitory tetrapeptide SWFP | Descriptor: | GLYCEROL, Karilysin protease, POTASSIUM ION, ... | Authors: | Guevara, T, Ksiazek, M, Skottrup, P.D, Cerda-Costa, N, Trillo-Muyo, S, de Diego, I, Riise, E, Potempa, J, Gomis-Ruth, F.X. | Deposit date: | 2013-01-04 | Release date: | 2013-05-15 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | Structure of the catalytic domain of the Tannerella forsythia matrix metallopeptidase karilysin in complex with a tetrapeptidic inhibitor. Acta Crystallogr.,Sect.F, 69, 2013
|
|
1OKR
| Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2003-07-28 | Release date: | 2003-10-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance J.Biol.Chem., 278, 2003
|
|
4INK
| Crystal structure of SplD protease from Staphylococcus aureus at 1.56 A resolution | Descriptor: | Serine protease SplD | Authors: | Zdzalik, M, Kalinska, M, Cichon, P, Wysocka, M, Stec-Niemczyk, J, Stennicke, H.R, Jabaiah, A, Markiewicz, M, Wladyka, B, Daugherty, P.S, Lesner, A, Rolka, K, Dubin, A, Potempa, J, Dubin, G. | Deposit date: | 2013-01-04 | Release date: | 2013-10-30 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.56 Å) | Cite: | Biochemical and Structural Characterization of SplD Protease from Staphylococcus aureus. Plos One, 8, 2013
|
|
4INL
| Crystal structure of SplD protease from Staphylococcus aureus at 2.1 A resolution | Descriptor: | Serine protease SplD | Authors: | Cichon, P, Zdzalik, M, Kalinska, M, Wysocka, M, Stec-Niemczyk, J, Stennicke, H.R, Jabaiah, A, Markiewicz, M, Wladyka, B, Daugherty, P.S, Lesner, A, Rolka, K, Dubin, A, Potempa, J, Dubin, G. | Deposit date: | 2013-01-04 | Release date: | 2013-10-30 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Biochemical and Structural Characterization of SplD Protease from Staphylococcus aureus. Plos One, 8, 2013
|
|
4K1T
| Gly-Ser-SplB protease from Staphylococcus aureus at 1.60 A resolution | Descriptor: | CHLORIDE ION, SULFATE ION, Serine protease SplB, ... | Authors: | Zdzalik, M, Pustelny, K, Stec-Niemczyk, J, Cichon, P, Czarna, A, Popowicz, G, Drag, M, Wladyka, B, Potempa, J, Dubin, A, Dubin, G. | Deposit date: | 2013-04-05 | Release date: | 2014-04-16 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Staphylococcal SplB Serine Protease Utilizes a Novel Molecular Mechanism of Activation. J.Biol.Chem., 289, 2014
|
|