5D4O
 
 | | Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DFN
 | | Structure of Tetrahymena Telomerase P45 C-terminal domain | | Descriptor: | Telomerase associated protein p45 | | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | | Deposit date: | 2015-08-27 | | Release date: | 2015-10-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.382 Å) | | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions.
Science, 350, 2015
|
|
5DFM
 | | Structure of Tetrahymena telomerase p19 fused to MBP | | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | | Deposit date: | 2015-08-27 | | Release date: | 2015-10-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.301 Å) | | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions.
Science, 350, 2015
|
|
5D4L
 | | Structure of the apo form of CPII from Thiomonas intermedia K12, a nitrogen regulatory PII-like protein | | Descriptor: | Nitrogen regulatory protein P-II | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5D4N
 | | Structure of CPII bound to ADP, AMP and acetate, from Thiomonas intermedia K12 | | Descriptor: | ACETATE ION, ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DTD
 | |
5E3L
 | |
5DRK
 | | 2.3 Angstrom Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-15 | | Release date: | 2016-10-12 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.38 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DS7
 | | 2.0 A Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound AMP | | Descriptor: | ADENOSINE MONOPHOSPHATE, CHLORIDE ION, Nitrogen regulatory protein P-II | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-17 | | Release date: | 2016-09-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DS9
 | |
5E3O
 | |
5E3N
 | |
3OGI
 | | Crystal structure of the Mycobacterium tuberculosis H37Rv EsxOP complex (Rv2346c-Rv2347c) | | Descriptor: | Putative ESAT-6-like protein 6, Putative ESAT-6-like protein 7 | | Authors: | Arbing, M.A, Chan, S, Zhou, T.T, Ahn, C, Harris, L, Kuo, E, Sawaya, M.R, Cascio, D, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI), TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2010-08-16 | | Release date: | 2010-08-25 | | Last modified: | 2014-05-21 | | Method: | X-RAY DIFFRACTION (2.549 Å) | | Cite: | Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions.
Plos One, 8, 2013
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2022-03-23 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
3K2R
 | | Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1 | | Descriptor: | CHLORIDE ION, HEXANE-1,6-DIOL, Lysozyme, ... | | Authors: | Toledo Warshaviak, D, Cascio, D, Khramtsov, V.V, Hubbell, W.L. | | Deposit date: | 2009-09-30 | | Release date: | 2010-10-13 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1
To be Published
|
|
3Q4H
 | | Crystal structure of the Mycobacterium smegmatis EsxGH complex (MSMEG_0620-MSMEG_0621) | | Descriptor: | Low molecular weight protein antigen 7, Pe family protein | | Authors: | Chan, S, Harris, L, Kuo, E, Ahn, C, Zhou, T.T, Nguyen, L, Shin, A, Sawaya, M.R, Cascio, D, Arbing, M.A, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI), TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2010-12-23 | | Release date: | 2011-01-26 | | Last modified: | 2014-05-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions.
Plos One, 8, 2013
|
|
5FOY
 | | De novo structure of the binary mosquito larvicide BinAB at pH 7 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2019-08-28 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
3L1F
 | | Bovine AlphaA crystallin | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Alpha-crystallin A chain | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.53 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3L1E
 | | Bovine AlphaA crystallin Zinc Bound | | Descriptor: | Alpha-crystallin A chain, GLYCEROL, ZINC ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.15 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3L1G
 | | Human AlphaB crystallin | | Descriptor: | Alpha-crystallin B chain, SULFATE ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.32 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
5FOZ
 | | De novo structure of the binary mosquito larvicide BinAB at pH 10 | | Descriptor: | LARVICIDAL TOXIN PROTEIN, SODIUM ION, TOXIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
3SGO
 | |
3SGS
 | |
3SGR
 | | Tandem repeat of amyloid-related segment of alphaB-crystallin residues 90-100 mutant V91L | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Tandem repeat of amyloid-related segment of alphaB-crystallin residues 90-100 mutant V91L | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2011-06-15 | | Release date: | 2012-03-21 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.17 Å) | | Cite: | Atomic view of a toxic amyloid small oligomer.
Science, 335, 2012
|
|
3H87
 | | Rv0301 Rv0300 Toxin Antitoxin Complex from Mycobacterium tuberculosis | | Descriptor: | BETA-MERCAPTOETHANOL, GLYCEROL, IMIDAZOLE, ... | | Authors: | Min, A, Sawaya, M.R, Cascio, D, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI) | | Deposit date: | 2009-04-28 | | Release date: | 2009-05-05 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.49 Å) | | Cite: | The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg(2+) ion in the active site and a putative RNA-binding site.
Protein Sci., 21, 2012
|
|
