4IHX
| |
4IHV
| |
4ZAR
| Crystal Structure of Proteinase K from Engyodontium albuminhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution | Descriptor: | CALCIUM ION, METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE, bound form, ... | Authors: | Sawaya, M.R, Cascio, D, Collazo, M, Bond, C, Cohen, A, DeNicola, A, Eden, K, Jain, K, Leung, C, Lubock, N, McCormick, J, Rosinski, J, Spiegelman, L, Athar, Y, Tibrewal, N, Winter, J, Solomon, S. | Deposit date: | 2015-04-14 | Release date: | 2015-05-06 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.15 Å) | Cite: | Crystal Structure of Proteinase K from Engyodontium album inhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution to be published
|
|
5ACM
| Mcg immunoglobulin variable domain with methylene blue | Descriptor: | 3,7-BIS(DIMETHYLAMINO)PHENOTHIAZIN-5-IUM, GLYCEROL, MCG, ... | Authors: | Brumshtein, B, Esswein, S.R, Salwinski, L, Phillips, M.L, Ly, A.T, Cascio, D, Sawaya, M.R, Eisenberg, D.S. | Deposit date: | 2015-08-17 | Release date: | 2015-12-02 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.05 Å) | Cite: | Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain. Elife, 4, 2015
|
|
5ACL
| Mcg immunoglobulin variable domain with sulfasalazine | Descriptor: | 2-HYDROXY-(5-([4-(2-PYRIDINYLAMINO)SULFONYL]PHENYL)AZO)BENZOIC ACID, MCG, SULFATE ION | Authors: | Brumshtein, B, Esswein, S.R, Salwinski, L, Phillips, M.L, Ly, A.T, Cascio, D, Sawaya, M.R, Eisenberg, D.S. | Deposit date: | 2015-08-17 | Release date: | 2015-12-02 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.49 Å) | Cite: | Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain. Elife, 4, 2015
|
|
5D4P
| Structure of CPII bound to ADP and bicarbonate, from Thiomonas intermedia K12 | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, Putative Nitrogen regulatory protein P-II GlnB | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-08-08 | Release date: | 2016-09-28 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5D4O
| Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-08-08 | Release date: | 2016-09-28 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5CUW
| |
5DFN
| Structure of Tetrahymena Telomerase P45 C-terminal domain | Descriptor: | Telomerase associated protein p45 | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | Deposit date: | 2015-08-27 | Release date: | 2015-10-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.382 Å) | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science, 350, 2015
|
|
5DFM
| Structure of Tetrahymena telomerase p19 fused to MBP | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | Deposit date: | 2015-08-27 | Release date: | 2015-10-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.301 Å) | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science, 350, 2015
|
|
5D4L
| Structure of the apo form of CPII from Thiomonas intermedia K12, a nitrogen regulatory PII-like protein | Descriptor: | Nitrogen regulatory protein P-II | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-08-08 | Release date: | 2016-09-28 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5D4N
| Structure of CPII bound to ADP, AMP and acetate, from Thiomonas intermedia K12 | Descriptor: | ACETATE ION, ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, ... | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-08-08 | Release date: | 2016-09-28 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5DTD
| |
5E3L
| |
5DRK
| 2.3 Angstrom Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-09-15 | Release date: | 2016-10-12 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.38 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5DS7
| 2.0 A Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound AMP | Descriptor: | ADENOSINE MONOPHOSPHATE, CHLORIDE ION, Nitrogen regulatory protein P-II | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | Deposit date: | 2015-09-17 | Release date: | 2016-09-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol., 428, 2016
|
|
5DS9
| |
5E3O
| |
5E3N
| |
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2022-03-23 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
3IDW
| |
3LE4
| |
3DH4
| Crystal Structure of Sodium/Sugar symporter with bound Galactose from vibrio parahaemolyticus | Descriptor: | ERBIUM (III) ION, SODIUM ION, Sodium/glucose cotransporter, ... | Authors: | Abramson, J, Faham, S, Cascio, D. | Deposit date: | 2008-06-16 | Release date: | 2008-08-05 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | The crystal structure of a sodium galactose transporter reveals mechanistic insights into Na+/sugar symport. Science, 321, 2008
|
|
4IBL
| Rubidium Sites in Blood Coagulation Factor VIIa | Descriptor: | BENZAMIDINE, CALCIUM ION, CHLORIDE ION, ... | Authors: | Vadivel, K, Schmidt, A, Cascio, D, Padmanabhan, K, Bajaj, S.P. | Deposit date: | 2012-12-08 | Release date: | 2014-04-16 | Last modified: | 2023-12-06 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structure of human factor VIIa-soluble tissue factor with calcium, magnesium and rubidium Acta Crystallogr.,Sect.D, D77, 2021
|
|
3EMN
| The Crystal Structure of Mouse VDAC1 at 2.3 A resolution | Descriptor: | 1,2-DIMYRISTOYL-RAC-GLYCERO-3-PHOSPHOCHOLINE, Voltage-dependent anion-selective channel protein 1 | Authors: | Ujwal, R, Cascio, D, Colletier, J.-P, Faham, S, Zhang, J, Toro, L, Ping, P, Abramson, J. | Deposit date: | 2008-09-24 | Release date: | 2008-12-16 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The crystal structure of mouse VDAC1 at 2.3 A resolution reveals mechanistic insights into metabolite gating Proc.Natl.Acad.Sci.USA, 105, 2008
|
|