7YNY
| |
5NCO
| Quaternary complex between SRP, SR, and SecYEG bound to the translating ribosome | Descriptor: | 23S rRNA, 4.5S SRP RNA (Ffs), 50S ribosomal protein L10, ... | Authors: | Jomaa, A, Hwang Fu, Y, Boerhinger, D, Leibundgut, M, Shan, S.O, Ban, N. | Deposit date: | 2017-03-06 | Release date: | 2017-05-24 | Last modified: | 2018-03-28 | Method: | ELECTRON MICROSCOPY (4.8 Å) | Cite: | Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome. Nat Commun, 8, 2017
|
|
4P0P
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0Q
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0S
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0R
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
5WBS
| Crystal structure of Frizzled-7 CRD with an inhibitor peptide Fz7-21 | Descriptor: | Frizzled-7,inhibitor peptide Fz7-21 | Authors: | Nile, A.H, Mukund, S, Hannoush, R.N, Wang, W. | Deposit date: | 2017-06-29 | Release date: | 2018-04-18 | Last modified: | 2018-05-30 | Method: | X-RAY DIFFRACTION (2.88 Å) | Cite: | A selective peptide inhibitor of Frizzled 7 receptors disrupts intestinal stem cells. Nat. Chem. Biol., 14, 2018
|
|
4OVA
| |
5I2K
| Structure of the human GluN1/GluN2A LBD in complex with 7-{[ethyl(4-fluorophenyl)amino]methyl}-N,2-dimethyl-5-oxo-5H-[1,3]thiazolo[3,2-a]pyrimidine-3-carboxamide (compound 19) | Descriptor: | 7-{[ethyl(4-fluorophenyl)amino]methyl}-N,2-dimethyl-5-oxo-5H-[1,3]thiazolo[3,2-a]pyrimidine-3-carboxamide, GLUTAMIC ACID, GLYCINE, ... | Authors: | Wallweber, H.J.A, Lupardus, P.J. | Deposit date: | 2016-02-09 | Release date: | 2016-03-16 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Discovery of GluN2A-Selective NMDA Receptor Positive Allosteric Modulators (PAMs): Tuning Deactivation Kinetics via Structure-Based Design. J.Med.Chem., 59, 2016
|
|
8INZ
| Cryo-EM structure of human HCN3 channel in apo state | Descriptor: | 4-[[(2~{S},4~{a}~{R},6~{S},8~{a}~{S})-6-[(4~{S},5~{R})-4-[(2~{S})-butan-2-yl]-5,9-dimethyl-decyl]-4~{a}-methyl-2,3,4,5,6,7,8,8~{a}-octahydro-1~{H}-naphthalen-2-yl]oxy]-4-oxidanylidene-butanoic acid, Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 | Authors: | Yu, B, Lu, Q.Y, Li, J, Zhang, J. | Deposit date: | 2023-03-10 | Release date: | 2024-04-10 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (2.72 Å) | Cite: | Cryo-EM structure of human HCN3 channel and its regulation by cAMP. J.Biol.Chem., 300, 2024
|
|
7EO0
| FOOT AND MOUTH DISEASE VIRUS O/TIBET/99-BOUND THE SINGLE CHAIN FRAGMEN ANTIBODY C4 | Descriptor: | Ig heavy chain variable region, Ig lamda chain variable region, O/TIBET/99 VP1, ... | Authors: | He, Y, Li, K. | Deposit date: | 2021-04-21 | Release date: | 2021-08-18 | Last modified: | 2022-02-23 | Method: | ELECTRON MICROSCOPY (3.75 Å) | Cite: | Two Cross-Protective Antigen Sites on Foot-and-Mouth Disease Virus Serotype O Structurally Revealed by Broadly Neutralizing Antibodies from Cattle. J.Virol., 95, 2021
|
|
8D0Z
| S728-1157 IgG in complex with SARS-CoV-2-6P-Mut7 Spike protein (focused refinement) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, S728-1157 Fab heavy chain variable region, S728-1157 Fab light chain variable region, ... | Authors: | Ozorowski, G, Torres, J.L, Ward, A.B. | Deposit date: | 2022-05-26 | Release date: | 2023-03-22 | Last modified: | 2023-05-03 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Site of vulnerability on SARS-CoV-2 spike induces broadly protective antibody against antigenically distinct Omicron subvariants. J.Clin.Invest., 133, 2023
|
|
6BZ1
| MEF2 Chimera D83V mutant/DNA complex | Descriptor: | DNA (5'-D(P*AP*AP*CP*TP*AP*TP*TP*TP*AP*TP*AP*AP*GP*A)-3'), DNA (5'-D(P*TP*TP*CP*TP*TP*AP*TP*AP*AP*AP*TP*AP*GP*TP*T)-3'), MEF2 CHIMERA | Authors: | Lei, X, Chen, L. | Deposit date: | 2017-12-21 | Release date: | 2018-02-07 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.97 Å) | Cite: | The Cancer Mutation D83V Induces an alpha-Helix to beta-Strand Conformation Switch in MEF2B. J. Mol. Biol., 430, 2018
|
|
6BYY
| MEF2 CHIMERA/DNA Complex | Descriptor: | 2-(2-{2-[2-(2-METHOXY-ETHOXY)-ETHOXY]-ETHOXY}-ETHOXY)-ETHANOL, 3,3',3''-phosphanetriyltripropanoic acid, DNA (5'-D(P*AP*AP*CP*TP*AP*TP*TP*TP*AP*TP*AP*AP*GP*A)-3'), ... | Authors: | Lei, X, Chen, L. | Deposit date: | 2017-12-21 | Release date: | 2018-01-31 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The Cancer Mutation D83V Induces an alpha-Helix to beta-Strand Conformation Switch in MEF2B. J. Mol. Biol., 430, 2018
|
|
7DYS
| |
6O3A
| Crystal structure of Frizzled 7 CRD in complex with F7.B Fab | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, 3-CYCLOHEXYL-1-PROPYLSULFONIC ACID, ... | Authors: | Raman, S, Beilschmidt, M, Fransson, J, Julien, J.P. | Deposit date: | 2019-02-26 | Release date: | 2019-04-03 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structure-guided design fine-tunes pharmacokinetics, tolerability, and antitumor profile of multispecific frizzled antibodies. Proc. Natl. Acad. Sci. U.S.A., 116, 2019
|
|
6O3B
| Crystal structure of Frizzled 7 CRD in complex with F6 Fab | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Antibody Fab F6, Heavy chain, ... | Authors: | Raman, S, Beilschmidt, M, Fransson, J, Julien, J.P. | Deposit date: | 2019-02-26 | Release date: | 2019-04-03 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structure-guided design fine-tunes pharmacokinetics, tolerability, and antitumor profile of multispecific frizzled antibodies. Proc. Natl. Acad. Sci. U.S.A., 116, 2019
|
|
6O39
| Crystal structure of Frizzled 5 CRD in complex with F2.I Fab | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETATE ION, ... | Authors: | Raman, S, Beilschmidt, M, Fransson, J, Julien, J.P. | Deposit date: | 2019-02-26 | Release date: | 2019-04-03 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structure-guided design fine-tunes pharmacokinetics, tolerability, and antitumor profile of multispecific frizzled antibodies. Proc. Natl. Acad. Sci. U.S.A., 116, 2019
|
|
4HYX
| Crystal Structure Analysis of the Bacteriorhodopsin in Facial Amphiphile-4 DMPC Bicelle | Descriptor: | Bacteriorhodopsin, DECANE, GLYCEROL, ... | Authors: | Lee, S, Stout, C.D, Zhang, Q. | Deposit date: | 2012-11-14 | Release date: | 2013-03-20 | Last modified: | 2013-05-22 | Method: | X-RAY DIFFRACTION (1.99 Å) | Cite: | Steroid-based facial amphiphiles for stabilization and crystallization of membrane proteins. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
7U38
| Pixantrone tethered DNA duplex | Descriptor: | 1,2-ETHANEDIOL, Pixantrone AP conjugate-modified DNA | Authors: | Pallan, P.S, Egli, M. | Deposit date: | 2022-02-26 | Release date: | 2023-03-15 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.49 Å) | Cite: | Structural Characterization of a Covalent Conjugate between Pixantrone and an Abasic Site in DNA To Be Published
|
|
7CA8
| The crystal structure of COVID-19 main protease in complex with an inhibitor Shikonin | Descriptor: | 2-[(1R)-4-methyl-1-oxidanyl-pent-3-enyl]-5,8-bis(oxidanyl)naphthalene-1,4-dione, 3C-like proteinase | Authors: | Zhou, X.L, Zhong, F.L, Lin, C, Li, J, Zhang, J. | Deposit date: | 2020-06-08 | Release date: | 2021-04-07 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Crystal structure of SARS-CoV-2 main protease in complex with the natural product inhibitor shikonin illuminates a unique binding mode. Sci Bull (Beijing), 66, 2021
|
|
7MIZ
| Atomic structure of cortical microtubule from Toxoplasma gondii | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Wang, X, Brown, A, Sibley, L.D, Zhang, R. | Deposit date: | 2021-04-18 | Release date: | 2021-06-02 | Last modified: | 2021-06-09 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Cryo-EM structure of cortical microtubules from human parasite Toxoplasma gondii identifies their microtubule inner proteins. Nat Commun, 12, 2021
|
|
4NPL
| |
6JPJ
| Crystal structure of FGF401 in complex of FGFR4 | Descriptor: | Fibroblast growth factor receptor 4, N-[5-cyano-4-(2-methoxyethylamino)pyridin-2-yl]-7-methanoyl-6-[(4-methyl-2-oxidanylidene-piperazin-1-yl)methyl]-3,4-dihydro-2H-1,8-naphthyridine-1-carboxamide, SULFATE ION | Authors: | Zhou, Z, Chen, X, Chen, Y. | Deposit date: | 2019-03-27 | Release date: | 2019-05-15 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.638 Å) | Cite: | Characterization of FGF401 as a reversible covalent inhibitor of fibroblast growth factor receptor 4. Chem.Commun.(Camb.), 55, 2019
|
|
4NPM
| |