3H8T
 
 | | Structure of Porphyromonas gingivalis heme-binding protein HmuY in complex with Heme | | Descriptor: | GLYCEROL, HmuY, PROTOPORPHYRIN IX CONTAINING FE, ... | | Authors: | Wojtowicz, H, Guevara, T, Tallant, C, Olczak, M, Sroka, A, Potempa, J, Sola, M, Olczak, T, Gomis-Ruth, F.X. | | Deposit date: | 2009-04-29 | | Release date: | 2009-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Unique structure and stability of HmuY, a novel heme-binding protein of Porphyromonas gingivalis
Plos Pathog., 5, 2009
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
1X9Y
 | | The prostaphopain B structure | | Descriptor: | cysteine proteinase | | Authors: | Filipek, R, Szczepanowski, R, Sabat, A, Potempa, J, Bochtler, M. | | Deposit date: | 2004-08-24 | | Release date: | 2004-11-23 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Prostaphopain B structure: a comparison of proregion-mediated and staphostatin-mediated protease inhibition.
Biochemistry, 43, 2004
|
|
7PV7
 | | Crystal structure of dimeric Porphyromonas gingivalis PorX, a type 9 secretion system response regulator. | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FORMIC ACID, GLYCEROL, ... | | Authors: | Schmitz, C.A, Madej, M, Potempa, J, Sola, M. | | Deposit date: | 2021-10-01 | | Release date: | 2022-12-14 | | Last modified: | 2022-12-28 | | Method: | X-RAY DIFFRACTION (2.41 Å) | | Cite: | Response regulator PorX coordinates oligonucleotide signalling and gene expression to control the secretion of virulence factors.
Nucleic Acids Res., 50, 2022
|
|
7PVK
 | | X-ray structure of dimeric PorX (T272A mutant), in complex with pGpG. | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FORMIC ACID, GLYCEROL, ... | | Authors: | Schmitz, C.A, Madej, M, Potempa, J, Sola, M. | | Deposit date: | 2021-10-04 | | Release date: | 2022-12-14 | | Last modified: | 2023-01-11 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Response regulator PorX coordinates oligonucleotide signalling and gene expression to control the secretion of virulence factors
Nucleic Acids Res., 50, 2022
|
|
7PVA
 | | 1.9 Angstrom crystal structure of dimeric PorX, co-crystallized in the presence of zinc | | Descriptor: | BERYLLIUM TRIFLUORIDE ION, CHLORIDE ION, FORMIC ACID, ... | | Authors: | Schmitz, C.A, Madej, M, Potempa, J, Sola, M. | | Deposit date: | 2021-10-01 | | Release date: | 2022-12-14 | | Last modified: | 2022-12-28 | | Method: | X-RAY DIFFRACTION (1.91 Å) | | Cite: | Response regulator PorX coordinates oligonucleotide signalling and gene expression to control the secretion of virulence factors.
Nucleic Acids Res., 50, 2022
|
|
5MUN
 | | Structural insight into zymogenic latency of gingipain K from Porphyromonas gingivalis. | | Descriptor: | AZIDE ION, Lys-gingipain W83 | | Authors: | Pomowski, A, Uson, I, Nowakovska, Z, Veillard, F, Sztukowska, M.N, Guevara, T, Goulas, T, Mizgalska, D, Nowak, M, Potempa, B, Huntington, J.A, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2017-01-13 | | Release date: | 2017-02-22 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome.
J. Biol. Chem., 292, 2017
|
|
6ZA2
 | | Crystal structure of dimeric latent PorU from Porphyromonas gingivalis | | Descriptor: | CALCIUM ION, Por secretion system protein porU | | Authors: | Gomis-Ruth, F.X, Goulas, T, Guevara, T, Rodriguez-Banqueri, A, Potempa, J. | | Deposit date: | 2020-06-04 | | Release date: | 2021-09-29 | | Last modified: | 2021-10-13 | | Method: | X-RAY DIFFRACTION (3.35 Å) | | Cite: | Intermolecular latency regulates the essential C-terminal signal peptidase and sortase of the Porphyromonas gingivalis type-IX secretion system.
Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
4YTB
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) in complex with dipeptide Asp-Gln. | | Descriptor: | ASPARTIC ACID, AZIDE ION, CHLORIDE ION, ... | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YTG
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) mutant C351A in complex with dipeptide Met-Arg. | | Descriptor: | ARGININE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YT9
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) substrate-unbound. | | Descriptor: | GLYCEROL, Peptidylarginine deiminase, SODIUM ION | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-15 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4IN9
 | | Structure of karilysin MMP-like catalytic domain in complex with inhibitory tetrapeptide SWFP | | Descriptor: | GLYCEROL, Karilysin protease, POTASSIUM ION, ... | | Authors: | Guevara, T, Ksiazek, M, Skottrup, P.D, Cerda-Costa, N, Trillo-Muyo, S, de Diego, I, Riise, E, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2013-01-04 | | Release date: | 2013-05-15 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Structure of the catalytic domain of the Tannerella forsythia matrix metallopeptidase karilysin in complex with a tetrapeptidic inhibitor.
Acta Crystallogr.,Sect.F, 69, 2013
|
|
1PXV
 | | The staphostatin-staphopain complex: a forward binding inhibitor in complex with its target cysteine protease | | Descriptor: | GUANIDINE, SULFATE ION, cysteine protease, ... | | Authors: | Filipek, R, Rzychon, M, Oleksy, A, Gruca, M, Dubin, A, Potempa, J, Bochtler, M. | | Deposit date: | 2003-07-07 | | Release date: | 2003-10-21 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | The Staphostatin-Staphopain Complex: A FORWARD BINDING INHIBITOR IN COMPLEX WITH ITS TARGET CYSTEINE PROTEASE.
J.Biol.Chem., 278, 2003
|
|
4INK
 | | Crystal structure of SplD protease from Staphylococcus aureus at 1.56 A resolution | | Descriptor: | Serine protease SplD | | Authors: | Zdzalik, M, Kalinska, M, Cichon, P, Wysocka, M, Stec-Niemczyk, J, Stennicke, H.R, Jabaiah, A, Markiewicz, M, Wladyka, B, Daugherty, P.S, Lesner, A, Rolka, K, Dubin, A, Potempa, J, Dubin, G. | | Deposit date: | 2013-01-04 | | Release date: | 2013-10-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.56 Å) | | Cite: | Biochemical and Structural Characterization of SplD Protease from Staphylococcus aureus.
Plos One, 8, 2013
|
|
4INL
 | | Crystal structure of SplD protease from Staphylococcus aureus at 2.1 A resolution | | Descriptor: | Serine protease SplD | | Authors: | Cichon, P, Zdzalik, M, Kalinska, M, Wysocka, M, Stec-Niemczyk, J, Stennicke, H.R, Jabaiah, A, Markiewicz, M, Wladyka, B, Daugherty, P.S, Lesner, A, Rolka, K, Dubin, A, Potempa, J, Dubin, G. | | Deposit date: | 2013-01-04 | | Release date: | 2013-10-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Biochemical and Structural Characterization of SplD Protease from Staphylococcus aureus.
Plos One, 8, 2013
|
|
4K1S
 | | Gly-Ser-SplB protease from Staphylococcus aureus at 1.96 A resolution | | Descriptor: | Serine protease SplB | | Authors: | Zdzalik, M, Pustelny, K, Stec-Niemczyk, J, Cichon, P, Czarna, A, Popowicz, G, Drag, M, Wladyka, B, Potempa, J, Dubin, A, Dubin, G. | | Deposit date: | 2013-04-05 | | Release date: | 2014-04-16 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (1.96 Å) | | Cite: | Staphylococcal SplB Serine Protease Utilizes a Novel Molecular Mechanism of Activation.
J.Biol.Chem., 289, 2014
|
|
4K1T
 | | Gly-Ser-SplB protease from Staphylococcus aureus at 1.60 A resolution | | Descriptor: | CHLORIDE ION, SULFATE ION, Serine protease SplB, ... | | Authors: | Zdzalik, M, Pustelny, K, Stec-Niemczyk, J, Cichon, P, Czarna, A, Popowicz, G, Drag, M, Wladyka, B, Potempa, J, Dubin, A, Dubin, G. | | Deposit date: | 2013-04-05 | | Release date: | 2014-04-16 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Staphylococcal SplB Serine Protease Utilizes a Novel Molecular Mechanism of Activation.
J.Biol.Chem., 289, 2014
|
|
4MVN
 | | Crystal structure of the staphylococcal serine protease SplA in complex with a specific phosphonate inhibitor | | Descriptor: | Serine protease splA, [(1S)-1-{[(benzyloxy)carbonyl]amino}-2-phenylethyl]phosphonic acid | | Authors: | Zdzalik, M, Burchacka, E, Niemczyk, J.S, Pustelny, K, Popowicz, G.M, Wladyka, B, Dubin, A, Potempa, J, Sienczyk, M, Dubin, G, Oleksyszyn, J. | | Deposit date: | 2013-09-24 | | Release date: | 2014-01-22 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Development and binding characteristics of phosphonate inhibitors of SplA protease from Staphylococcus aureus.
Protein Sci., 23, 2014
|
|
1OH1
 | | Solution structure of staphostatin A form Staphylococcus aureus confirms the discovery of a novel class of cysteine proteinase inhibitors. | | Descriptor: | STAPHOSTATIN A | | Authors: | Dubin, G, Popowicz, G, Krajewski, M, Stec, J, Bochtler, M, Potempa, J, Dubin, A, Holak, T.A. | | Deposit date: | 2003-05-21 | | Release date: | 2003-11-20 | | Last modified: | 2011-07-13 | | Method: | SOLUTION NMR | | Cite: | A Novel Class of Cysteine Protease Inhibitors: Solution Structure of Staphostatin a from Staphylococcus Aureus
Biochemistry, 42, 2003
|
|
5M11
 | | Structural and functional probing of PorZ, an essential bacterial surface component of the type-IX secretion system of human oral-microbiomic Porphyromonas gingivalis. | | Descriptor: | CACODYLATE ION, CALCIUM ION, CHLORIDE ION, ... | | Authors: | Lasica, A.M, Goulas, T, Mizgalska, D, Zhou, X, Ksiazek, M, Madej, M, Guo, Y, Guevara, T, Nowak, M, Potempa, B, Goel, A, Sztukowska, M, Prabhakar, A.T, Bzowska, M, Widziolek, M, Thogersen, I.B, Enghild, J.J, Simonian, M, Kulczyk, A.W, Nguyen, K.-A, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2016-10-07 | | Release date: | 2016-11-09 | | Last modified: | 2022-03-30 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural and functional probing of PorZ, an essential bacterial surface component of the type-IX secretion system of human oral-microbiomic Porphyromonas gingivalis.
Sci Rep, 6, 2016
|
|
1NYC
 | | Staphostatins resemble lipocalins, not cystatins in fold. | | Descriptor: | CHLORIDE ION, SULFATE ION, cysteine protease inhibitor | | Authors: | Rzychon, M, Filipek, R, Sabat, A, Kosowska, K, Dubin, A, Potempa, J, Bochtler, M. | | Deposit date: | 2003-02-12 | | Release date: | 2003-09-30 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Staphostatins resemble lipocalins, not cystatins in fold.
Protein Sci., 12, 2003
|
|
3BB7
 | | Structure of Prevotella intermedia prointerpain A fragment 39-359 (mutant C154A) | | Descriptor: | interpain A | | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2007-11-09 | | Release date: | 2007-11-20 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A
J.Biol.Chem., 283, 2008
|
|
4R3V
 | | Structure of karilysin propeptide and catalytic MMP domain | | Descriptor: | CALCIUM ION, GLYCEROL, Karilysin, ... | | Authors: | Lopez-Pelegrin, M, Ksiazek, M, Karim, A.Y, Guevara, T, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2014-08-18 | | Release date: | 2015-01-07 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.01 Å) | | Cite: | A novel mechanism of latency in matrix metalloproteinases.
J.Biol.Chem., 290, 2015
|
|
3BBA
 | | Structure of active wild-type Prevotella intermedia interpain A cysteine protease | | Descriptor: | interpain A | | Authors: | Mallorqui-Fernandez, N, Manandhar, S.P, Mallorqui-Fernandez, G, Uson, I, Wawrzonek, K, Kantyka, T, Sola, M, Thogersen, I.B, Enghild, J.J, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2007-11-09 | | Release date: | 2007-11-20 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | A New Autocatalytic Activation Mechanism for Cysteine Proteases Revealed by Prevotella intermedia Interpain A
J.Biol.Chem., 283, 2008
|
|
1BQB
 | | AUREOLYSIN, STAPHYLOCOCCUS AUREUS METALLOPROTEINASE | | Descriptor: | CALCIUM ION, PROTEIN (AUREOLYSIN), ZINC ION | | Authors: | Medrano, F.J, Banbula, A, Potempa, J, Travis, J, Bode, W. | | Deposit date: | 1998-07-14 | | Release date: | 1999-01-13 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (1.72 Å) | | Cite: | Amino-acid sequence and three-dimensional structure of the Staphylococcus aureus metalloproteinase at 1.72 A resolution.
Structure, 6, 1998
|
|
