5E3L
 
 | |
5E3N
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
4MWG
 | | Crystal structure of Burkholderia xenovorans DmrB apo form: A Cubic Protein Cage for Redox Transfer | | Descriptor: | Putative dihydromethanopterin reductase (AfpA), SULFATE ION | | Authors: | Bobik, T.A, Cascio, D, Jorda, J, McNamara, D.E, Bustos, C, Wang, T.C, Rasche, M.E, Yeates, T.O. | | Deposit date: | 2013-09-24 | | Release date: | 2014-02-19 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure of dihydromethanopterin reductase, a cubic protein cage for redox transfer
J.Biol.Chem., 289, 2014
|
|
5VOS
 | | VGSNKGAIIGL from Amyloid Beta determined by MicroED | | Descriptor: | Amyloid beta A4 protein | | Authors: | Rodriguez, J.A, Sawaya, M.R, Cascio, D, Eisenberg, D.S, Griner, S.L, Gonen, T. | | Deposit date: | 2017-05-03 | | Release date: | 2018-01-03 | | Last modified: | 2024-03-13 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.42 Å) | | Cite: | Common fibrillar spines of amyloid-beta and human islet amyloid polypeptide revealed by microelectron diffraction and structure-based inhibitors.
J. Biol. Chem., 293, 2018
|
|
5DRK
 | | 2.3 Angstrom Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-15 | | Release date: | 2016-10-12 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.38 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DS7
 | | 2.0 A Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound AMP | | Descriptor: | ADENOSINE MONOPHOSPHATE, CHLORIDE ION, Nitrogen regulatory protein P-II | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-17 | | Release date: | 2016-09-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5E3O
 | |
4NL9
 | |
5DS9
 | |
5FOZ
 | | De novo structure of the binary mosquito larvicide BinAB at pH 10 | | Descriptor: | LARVICIDAL TOXIN PROTEIN, SODIUM ION, TOXIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
5FOY
 | | De novo structure of the binary mosquito larvicide BinAB at pH 7 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
4E4E
 | |
3DH4
 | | Crystal Structure of Sodium/Sugar symporter with bound Galactose from vibrio parahaemolyticus | | Descriptor: | ERBIUM (III) ION, SODIUM ION, Sodium/glucose cotransporter, ... | | Authors: | Abramson, J, Faham, S, Cascio, D. | | Deposit date: | 2008-06-16 | | Release date: | 2008-08-05 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The crystal structure of a sodium galactose transporter reveals mechanistic insights into Na+/sugar symport.
Science, 321, 2008
|
|
4EDI
 | | Disulfide bonded EutL from Clostridium perfringens | | Descriptor: | Ethanolamine utilization protein, SODIUM ION | | Authors: | Thompson, M.C, Cascio, D, Crowley, C.S, Kopstein, J.S, Yeates, T.O. | | Deposit date: | 2012-03-27 | | Release date: | 2013-03-27 | | Last modified: | 2024-11-27 | | Method: | X-RAY DIFFRACTION (1.998 Å) | | Cite: | An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein.
Protein Sci., 24, 2015
|
|
3L1E
 | | Bovine AlphaA crystallin Zinc Bound | | Descriptor: | Alpha-crystallin A chain, GLYCEROL, ZINC ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.15 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3L1G
 | | Human AlphaB crystallin | | Descriptor: | Alpha-crystallin B chain, SULFATE ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.32 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
4EYT
 | | Crystal structure of the C-terminal domain of Tetrahymena telomerase protein p65 | | Descriptor: | SULFATE ION, Telomerase associated protein p65 | | Authors: | Singh, M, Wang, Z, Koo, B.-K, Patel, A, Cascio, D, Collins, K, Feigon, J. | | Deposit date: | 2012-05-01 | | Release date: | 2012-06-20 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65.
Mol.Cell, 47, 2012
|
|
4FDZ
 | | EutL from Clostridium perfringens, Crystallized Under Reducing Conditions | | Descriptor: | Ethanolamine utilization protein, SODIUM ION | | Authors: | Thompson, M.C, Cascio, D, Crowley, C.S, Kopstein, J.S, Yeates, T.O. | | Deposit date: | 2012-05-29 | | Release date: | 2013-05-29 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.802 Å) | | Cite: | An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein.
Protein Sci., 24, 2015
|
|
3EMN
 | | The Crystal Structure of Mouse VDAC1 at 2.3 A resolution | | Descriptor: | 1,2-DIMYRISTOYL-RAC-GLYCERO-3-PHOSPHOCHOLINE, Voltage-dependent anion-selective channel protein 1 | | Authors: | Ujwal, R, Cascio, D, Colletier, J.-P, Faham, S, Zhang, J, Toro, L, Ping, P, Abramson, J. | | Deposit date: | 2008-09-24 | | Release date: | 2008-12-16 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The crystal structure of mouse VDAC1 at 2.3 A resolution reveals mechanistic insights into metabolite gating
Proc.Natl.Acad.Sci.USA, 105, 2008
|
|
3L1F
 | | Bovine AlphaA crystallin | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Alpha-crystallin A chain | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.53 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3TH4
 | | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla) Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+ | | Descriptor: | CALCIUM ION, CHLORIDE ION, Coagulation factor VII heavy chain, ... | | Authors: | Vadivel, K, Agah, S, Cascio, D, Padmanabhan, K, Bajaj, S.P. | | Deposit date: | 2011-08-18 | | Release date: | 2012-08-22 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla)
Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+
To be Published
|
|
3TH3
 | | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla) Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+ | | Descriptor: | CALCIUM ION, CHLORIDE ION, Coagulation factor VII heavy chain, ... | | Authors: | Vadivel, K, Agah, S, Cascio, D, Padmanabhan, K, Bajaj, S.P. | | Deposit date: | 2011-08-18 | | Release date: | 2012-08-22 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla)
Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+
To be Published
|
|
3TH2
 | | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla) Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+ | | Descriptor: | BENZAMIDINE, CALCIUM ION, CHLORIDE ION, ... | | Authors: | Vadivel, K, Agah, S, Cascio, D, Padmanabhan, K, Bajaj, S.P. | | Deposit date: | 2011-08-18 | | Release date: | 2012-08-22 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (1.72 Å) | | Cite: | Mg2+ Is Required for Optimal Folding of the Gamma-Carboxyglutamic Acid (Gla)
Domains of Vitamin K-Dependent Clotting Factors At Physiological Ca2+
To be Published
|
|
3UC9
 | |
