5DTD
 
 | |
5E3L
 | |
1SJN
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and alpha,beta-imido-dUTP | | Descriptor: | 2'-DEOXYURIDINE 5'-ALPHA,BETA-IMIDO-TRIPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-04 | | Release date: | 2004-03-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
5DS9
 | |
5E3N
 | |
5E3O
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
1SLH
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and dUDP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-DIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-05 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
3K2R
 | | Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1 | | Descriptor: | CHLORIDE ION, HEXANE-1,6-DIOL, Lysozyme, ... | | Authors: | Toledo Warshaviak, D, Cascio, D, Khramtsov, V.V, Hubbell, W.L. | | Deposit date: | 2009-09-30 | | Release date: | 2010-10-13 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystal Structure of Spin Labeled T4 Lysozyme Mutant K65V1/R76V1
To be Published
|
|
5FOY
 | | De novo structure of the binary mosquito larvicide BinAB at pH 7 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2019-08-28 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
5DRK
 | | 2.3 Angstrom Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound to ADP, AMP and bicarbonate. | | Descriptor: | ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, BICARBONATE ION, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-15 | | Release date: | 2016-10-12 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.38 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5DS7
 | | 2.0 A Structure of CPII, a nitrogen regulatory PII-like protein from Thiomonas intermedia K12, bound AMP | | Descriptor: | ADENOSINE MONOPHOSPHATE, CHLORIDE ION, Nitrogen regulatory protein P-II | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-09-17 | | Release date: | 2016-09-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
5FOZ
 | | De novo structure of the binary mosquito larvicide BinAB at pH 10 | | Descriptor: | LARVICIDAL TOXIN PROTEIN, SODIUM ION, TOXIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
5D4N
 | | Structure of CPII bound to ADP, AMP and acetate, from Thiomonas intermedia K12 | | Descriptor: | ACETATE ION, ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
1SIX
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and alpha,beta-imido-dUTP | | Descriptor: | 2'-DEOXYURIDINE 5'-ALPHA,BETA-IMIDO-TRIPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.-S, Kim, M, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-01 | | Release date: | 2004-03-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SMC
 | | Mycobacterium tuberculosis dUTPase complexed with dUTP in the absence of metal ion. | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-TRIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-09 | | Release date: | 2004-03-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
2LSL
 | | Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65 | | Descriptor: | Telomerase associated protein p65 | | Authors: | Singh, M, Wang, Z, Koo, B, Patel, A, Cascio, D, Collins, K, Feigon, J. | | Deposit date: | 2012-05-01 | | Release date: | 2012-06-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65.
Mol.Cell, 47, 2012
|
|
3H6P
 | | Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis | | Descriptor: | ESAT-6 LIKE PROTEIN ESXS, ESAT-6-like protein esxR, GLYCEROL | | Authors: | Chan, S, Arbing, M, Phan, T, Kaufmann, M, Cascio, D, Eisenberg, D, TB Structural Genomics Consortium (TBSGC), Integrated Center for Structure and Function Innovation (ISFI) | | Deposit date: | 2009-04-23 | | Release date: | 2009-06-30 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.91 Å) | | Cite: | Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis
To be Published
|
|
4ZAR
 | | Crystal Structure of Proteinase K from Engyodontium albuminhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution | | Descriptor: | CALCIUM ION, METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE, bound form, ... | | Authors: | Sawaya, M.R, Cascio, D, Collazo, M, Bond, C, Cohen, A, DeNicola, A, Eden, K, Jain, K, Leung, C, Lubock, N, McCormick, J, Rosinski, J, Spiegelman, L, Athar, Y, Tibrewal, N, Winter, J, Solomon, S. | | Deposit date: | 2015-04-14 | | Release date: | 2015-05-06 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.15 Å) | | Cite: | Crystal Structure of Proteinase K from Engyodontium album inhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution
to be published
|
|
5HQL
 | | Structure function studies of R. palustris RubisCO (A47V-M331A mutant; CABP-bound; no expression tag) | | Descriptor: | 2-CARBOXYARABINITOL-1,5-DIPHOSPHATE, MAGNESIUM ION, Ribulose bisphosphate carboxylase | | Authors: | Arbing, M.A, Shin, A, Cascio, D, Satagopan, S, North, J.A, Tabita, F.R. | | Deposit date: | 2016-01-21 | | Release date: | 2017-01-25 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.53 Å) | | Cite: | Structure function studies of R. palustris RubisCO
To Be Published
|
|
5ACL
 | | Mcg immunoglobulin variable domain with sulfasalazine | | Descriptor: | 2-HYDROXY-(5-([4-(2-PYRIDINYLAMINO)SULFONYL]PHENYL)AZO)BENZOIC ACID, MCG, SULFATE ION | | Authors: | Brumshtein, B, Esswein, S.R, Salwinski, L, Phillips, M.L, Ly, A.T, Cascio, D, Sawaya, M.R, Eisenberg, D.S. | | Deposit date: | 2015-08-17 | | Release date: | 2015-12-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.49 Å) | | Cite: | Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain.
Elife, 4, 2015
|
|
2MNW
 | |
5ACM
 | | Mcg immunoglobulin variable domain with methylene blue | | Descriptor: | 3,7-BIS(DIMETHYLAMINO)PHENOTHIAZIN-5-IUM, GLYCEROL, MCG, ... | | Authors: | Brumshtein, B, Esswein, S.R, Salwinski, L, Phillips, M.L, Ly, A.T, Cascio, D, Sawaya, M.R, Eisenberg, D.S. | | Deposit date: | 2015-08-17 | | Release date: | 2015-12-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.05 Å) | | Cite: | Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain.
Elife, 4, 2015
|
|
5HA7
 | | Human Aldose Reductase in Complex with NADP+ and WY14643 in Space Group P212121 | | Descriptor: | 2-({4-CHLORO-6-[(2,3-DIMETHYLPHENYL)AMINO]PYRIMIDIN-2-YL}SULFANYL)ACETIC ACID, Aldose reductase, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Sawaya, M.R, Cascio, D, Balendiran, G.K. | | Deposit date: | 2015-12-30 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Characterization of WY 14,643 and its Complex with Aldose Reductase.
Sci Rep, 6, 2016
|
|
2NTH
 | | Structure of Spin-labeled T4 Lysozyme Mutant L118R1 | | Descriptor: | Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2006-11-07 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
