3H8Q
 
 | | Crystal structure of glutaredoxin domain of human thioredoxin reductase 3 | | Descriptor: | CHLORIDE ION, SULFATE ION, Thioredoxin reductase 3 | | Authors: | Chaikuad, A, Johansson, C, Ugochukwu, E, Roos, A.K, von Delft, F, Pilka, E, Yue, W, Arrowsmith, C.H, Edwards, A.M, Weigelt, J, Bountra, C, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2009-04-29 | | Release date: | 2009-05-12 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Crystal structure of glutaredoxin domain of human thioredoxin reductase 3
To be Published
|
|
2F5Y
 | | Crystal Structure of the PDZ Domain from Human RGS-3 | | Descriptor: | SULFATE ION, regulator of G-protein signalling 3 isoform 1 | | Authors: | Ugochukwu, E, Berridge, G, Johansson, C, Smee, C, Savitsky, P, Burgess, N, Colebrook, S, Yang, X, Elkins, J, Doyle, D, Turnbull, A, Papagrigoriou, E, Debreczeni, J, Bunkoczi, G, Gorrec, F, von Delft, F, Arrowsmith, C, Sundstrom, M, Weigelt, J, Edwards, A, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-11-28 | | Release date: | 2005-12-13 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.39 Å) | | Cite: | Crystal Structure of the PDZ Domain from Human RGS-3
To be Published
|
|
2CLP
 | | Crystal structure of human aflatoxin B1 aldehyde reductase member 3 | | Descriptor: | AFLATOXIN B1 ALDEHYDE REDUCTASE MEMBER 3, CALCIUM ION, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | | Authors: | Debreczeni, J.E, Marsden, B.D, Johansson, C, Kavanagh, K, Guo, K, Smee, C, Gileadi, O, Turnbull, A, Papagrigoriou, E, von Delft, F, Edwards, A, Arrowsmith, C, Weigelt, J, Sundstrom, M, Oppermann, U. | | Deposit date: | 2006-04-28 | | Release date: | 2006-05-12 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal Structure of Human Aflatoxin B1 Aldehyde Reductase Member 3
To be Published
|
|
1Y2Y
 | | Structural Characterization of Nop10p using Nuclear Magnetic Resonance Spectroscopy | | Descriptor: | Ribosome biogenesis protein Nop10 | | Authors: | Khanna, M, Wu, H, Johansson, C, Caizergues-Ferrer, M, Feigon, J. | | Deposit date: | 2004-11-23 | | Release date: | 2005-12-06 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structural study of the H/ACA snoRNP components Nop10p and the 3' hairpin of U65 snoRNA
RNA, 12, 2006
|
|
6GPJ
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4F-Man | | Descriptor: | 1,2-ETHANEDIOL, CITRIC ACID, GDP-mannose 4,6 dehydratase, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
2O2T
 | | The crystal structure of the 1st PDZ domain of MPDZ | | Descriptor: | Multiple PDZ domain protein | | Authors: | Papagrigoriou, E, Gileadi, C, Phillips, C, Johansson, C, Salah, E, Savitsky, P, Gorrec, F, Umeano, C, Berridge, G, Pike, A.C.W, Elkins, J, Edwards, A, Arrowsmith, C, Weigelt, J, Sundstrom, M, Doyle, D.A, Structural Genomics Consortium (SGC) | | Deposit date: | 2006-11-30 | | Release date: | 2006-12-12 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The crystal structure of the 1st PDZ domain of MPDZ
To be Published
|
|
6GPK
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase (E157Q) in complex with GDP-Man | | Descriptor: | 1,2-ETHANEDIOL, GDP-mannose 4,6 dehydratase, GLYCEROL, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
6GPL
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4k6d-Man | | Descriptor: | 1,2-ETHANEDIOL, BICINE, GDP-mannose 4,6 dehydratase, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
3OP3
 | | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens | | Descriptor: | M-phase inducer phosphatase 3, SULFATE ION | | Authors: | Kim, Y, Weger, A, Hatzos, C, Savitsky, P, Johansson, C, Ball, L, Barr, A, Vollmar, M, Muniz, J, Weigelt, J, Arrowsmith, C.H, Edwards, A, Bountra, C, Gileadi, O, von Delft, F, Knapp, S, Joachimiak, A, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-08-31 | | Release date: | 2010-09-29 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens
TO BE PUBLISHED
|
|
3P1M
 | | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster | | Descriptor: | Adrenodoxin, mitochondrial, CITRATE ANION, ... | | Authors: | Chaikuad, A, Johansson, C, Krojer, T, Yue, W.W, Phillips, C, Bray, J.E, Pike, A.C.W, Muniz, J.R.C, Vollmar, M, Weigelt, J, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Kavanagh, K, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-09-30 | | Release date: | 2010-11-03 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.54 Å) | | Cite: | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster
To be Published
|
|
2CFY
 | | Crystal structure of human thioredoxin reductase 1 | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, THIOREDOXIN REDUCTASE 1 | | Authors: | Debreczeni, J.E, Johansson, C, Kavanagh, K, Savitsky, P, Sundstrom, M, Arrowsmith, C, Weigelt, J, Edwards, A, von Delft, F, Oppermann, U. | | Deposit date: | 2006-02-26 | | Release date: | 2006-03-09 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal Structure of Human Thioredoxin Reductase 1
To be Published
|
|
1QWB
 | |
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
2EXE
 | | Crystal structure of the phosphorylated CLK3 | | Descriptor: | Dual specificity protein kinase CLK3 | | Authors: | Papagrigoriou, E, Rellos, P, Das, S, Bullock, A, Ball, L.J, Turnbull, A, Savitsky, P, Fedorov, O, Johansson, C, Ugochukwu, E, Sobott, F, von Delft, F, Edwards, A, Sundstrom, M, Weigelt, J, Arrowsmith, C, Knapp, S, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-11-08 | | Release date: | 2005-11-15 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Crystal structure of the phosphorylated CLK3
TO BE PUBLISHED
|
|
2F8A
 | | Crystal structure of the selenocysteine to glycine mutant of human glutathione peroxidase 1 | | Descriptor: | Glutathione peroxidase 1, MALONIC ACID | | Authors: | Kavanagh, K.L, Johansson, C, Smee, C, Gileadi, O, von Delft, F, Weigelt, J, Sundstrom, M, Edwards, A, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-12-02 | | Release date: | 2005-12-13 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystal structure of the selenocysteine to glycine mutant of human glutathione peroxidase 1
To be Published
|
|
5FZD
 | | Crystal structure of the catalytic domain of human JARID1B in complex with L-2-hydroxyglutarate | | Descriptor: | (2S)-2-HYDROXYPENTANEDIOIC ACID, 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Nowak, R, Kopec, J, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2016-03-14 | | Release date: | 2017-03-22 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with L-2-Hydroxyglutarate
To be Published
|
|
5FYV
 | | Crystal structure of the catalytic domain of human JARID1B in complex with oxaloacetate | | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, CHLORIDE ION, ... | | Authors: | Nowak, R, Kopec, J, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2016-03-10 | | Release date: | 2017-03-22 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.87 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with Oxaloacetate
To be Published
|
|
5FZ3
 | | Crystal structure of the catalytic domain of human JARID1B in complex with Maybridge fragment 3,6-Dihydroxybenzonorbornane (N08776b) (ligand modelled based on PANDDA event map) | | Descriptor: | (1R,4S)-1,2,3,4-tetrahydro-1,4-methanonaphthalene-5,8-diol, 1,2-ETHANEDIOL, CHLORIDE ION, ... | | Authors: | Nowak, R, Krojer, T, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, Pearce, N, Talon, R, Collins, P, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-10 | | Release date: | 2016-03-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with N08776B
To be Published
|
|
5FZB
 | | Crystal structure of the catalytic domain of human JARID1B in complex with Maybridge fragment 4-Pyridylthiourea (N06275b) (ligand modelled based on PANDDA event map, SGC - Diamond I04-1 fragment screening) | | Descriptor: | 1,2-ETHANEDIOL, 1-pyridin-4-ylthiourea, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Nowak, R, Krojer, T, Johansson, C, Kupinska, K, Szykowska, A, Pearce, N, Talon, R, Collins, P, Gileadi, C, Strain-Damerell, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-12 | | Release date: | 2016-03-30 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.18 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with Maybridge Fragment 4-Pyridylthiourea (N06275B) (Ligand Modelled Based on Pandda Event Map, Sgc -Diamond I04-1 Fragment Screening)
To be Published
|
|
5FYY
 | | Crystal structure of the catalytic domain of human JARID1B in complex with Maybridge fragment 3-pyridin-3-ylaniline (N05798a) (ligand modelled based on PANDDA event map) | | Descriptor: | 1,2-ETHANEDIOL, 3-(pyridin-3-yl)aniline, CHLORIDE ION, ... | | Authors: | Nowak, R, Krojer, T, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, Pearce, N, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-10 | | Release date: | 2016-03-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.18 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with N05798A
To be Published
|
|
5FZ7
 | | Crystal structure of the catalytic domain of human JARID1B in complex with Maybridge fragment ethyl 2-amino-4-thiophen-2-ylthiophene-3- carboxylate (N06131b) (ligand modelled based on PANDDA event map, SGC - Diamond I04-1 fragment screening) | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, DIMETHYL SULFOXIDE, ... | | Authors: | Nowak, R, Krojer, T, Johansson, C, Kupinska, K, Szykowska, A, Pearce, N, Talon, R, Collins, P, Gileadi, C, Strain-Damerell, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-11 | | Release date: | 2016-03-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with Maybridge Fragment Ethyl 2-Amino-4-Thiophen-2-Ylthiophene-3-Carboxylate (N06131B) (Ligand Modelled Based on Pandda Event Map, Sgc - Diamond I04-1 Fragment Screening)
To be Published
|
|
5FZ0
 | | Crystal structure of the catalytic domain of human JARID1B in complex with 2,5-dichloro-N-(pyridin-3-yl)thiophene-3-carboxamide (N08137b) (ligand modelled based on PANDDA event map, SGC - Diamond I04-1 fragment screening) | | Descriptor: | 1,2-ETHANEDIOL, 2,5-dichloro-N-(pyridin-3-yl)thiophene-3-carboxamide, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Nowak, R, Krojer, T, Pearce, N, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-10 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.42 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with N11213A
To be Published
|
|
5FZA
 | | Crystal structure of the catalytic domain of human JARID1B in complex with 3D fragment 2-piperidin-4-yloxy-5-(trifluoromethyl)pyridine (N10072a) (ligand modelled based on PANDDA event map) | | Descriptor: | 1,2-ETHANEDIOL, 2-piperidin-4-yloxy-5-(trifluoromethyl)pyridine, CHLORIDE ION, ... | | Authors: | Nowak, R, Krojer, T, Pearce, N, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, von Delft, F, Brennan, P.E, Oppermann, U. | | Deposit date: | 2016-03-12 | | Release date: | 2016-03-30 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.099 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with 3D Fragment 2-Piperidin-4-Yloxy-5-(Trifluoromethyl)Pyridine (N10072A) (Ligand Modelled Based on Pandda Event Map)
To be Published
|
|
5FYB
 | | Crystal structure of the catalytic domain of human JARID1B in complex with MC1648 | | Descriptor: | 1,2-ETHANEDIOL, DIMETHYL SULFOXIDE, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | | Authors: | Nowak, R, Srikannathasan, V, Rotili, D, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2016-03-05 | | Release date: | 2017-03-29 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.87 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with Mc1648
To be Published
|
|
5FYS
 | | Crystal structure of the catalytic domain of human JARID1B in complex with D-2-hydroxyglutarate | | Descriptor: | (2R)-2-hydroxypentanedioic acid, 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Nowak, R, Kopec, J, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2016-03-09 | | Release date: | 2017-03-22 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Crystal Structure of the Catalytic Domain of Human Jarid1B in Complex with D-2-Hydroxyglutarate
To be Published
|
|
