3I55
 
 | | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.11 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
1WTT
 | |
3I56
 | | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
1YI2
 | | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-11 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YHQ
 | | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-10 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YIT
 | | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2024-07-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YIJ
 | | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-12 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJ9
 | | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJN
 | | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-14 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJW
 | | Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-15 | | Release date: | 2005-04-26 | | Last modified: | 2024-07-10 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
2A9L
 | |
3CPW
 | | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S ribosomal protein L10E, ... | | Authors: | Ippolito, J.A, Kanyo, Z.K, Wang, D, Franceschi, F.J, Moore, P.B, Steitz, T.A, Duffy, E.M. | | Deposit date: | 2008-04-01 | | Release date: | 2008-07-22 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal Structure of the Oxazolidinone Antibiotic
Linezolid Bound to the 50S Ribosomal Subunit
J.Med.Chem., 51, 2008
|
|
1MHK
 | | Crystal Structure Analysis of a 26mer RNA molecule, representing a new RNA motif, the hook-turn | | Descriptor: | BROMIDE ION, RNA 12-mer BCh12, RNA 14-mer BCh12 | | Authors: | Szep, S, Wang, J, Moore, P.B. | | Deposit date: | 2002-08-20 | | Release date: | 2002-09-06 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | The crystal structure of a 26-nucleotide RNA containing a hook-turn
RNA, 9, 2003
|
|
1M90
 | | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | | Descriptor: | 23S RRNA, 5S RRNA, 6-AMINOHEXANOIC ACID, ... | | Authors: | Hansen, J.L, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-07-26 | | Release date: | 2002-09-06 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural insights into peptide bond formation.
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
1M1K
 | | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, AZITHROMYCIN, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-06-19 | | Release date: | 2002-07-19 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
1OVY
 | |
1JUR
 | |
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1C04
 | | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | | Deposit date: | 1999-07-14 | | Release date: | 1999-08-31 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (5 Å) | | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
|
|
1SCL
 | |
1U3K
 | |
1SZY
 | |
1EHZ
 | |
