5FUP
 
 | | Crystal structure of human JARID1B in complex with 2-oxoglutarate. | | Descriptor: | 1,2-ETHANEDIOL, 2-OXOGLUTARIC ACID, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Nowak, R, Srikannathasan, V, Johansson, C, Gileadi, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, Talon, R, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2016-01-28 | | Release date: | 2016-03-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5FPU
 | | Crystal structure of human JARID1B in complex with GSKJ1 | | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propanoic acid, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Srikannathasan, V, Nowak, R, Johansson, C, Gileadi, C, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2015-12-03 | | Release date: | 2016-01-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.24 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5FWJ
 | | Crystal structure of human JARID1C in complex with KDM5-C49 | | Descriptor: | 2-{[(2-{[(E)-2-(dimethylamino)ethenyl](ethyl)amino}-2-oxoethyl)amino]methyl}pyridine-4-carboxylic acid, HISTONE DEMETHYLASE JARID1C, MAGNESIUM ION, ... | | Authors: | Srikannathasan, V, Szykowska, A, Strain-Damerell, C, Kopec, J, Nowak, R, Gileadi, C, Johansson, C, Kupinska, K, Burgess-Brown, N.A, Shrestha, L, Dong, W, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Huber, K, Oppermann, U. | | Deposit date: | 2016-02-17 | | Release date: | 2016-04-13 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
4UY4
 | | 1.86 A structure of human Spindlin-4 protein in complex with histone H3K4me3 peptide | | Descriptor: | GLYCEROL, HISTONE H3K4ME3, SPINDLIN-4 | | Authors: | Talon, R, Gileadi, C, Johansson, C, Burgess-Brown, N, Shrestha, L, von Delft, F, Krojer, T, Fairhead, M, Bountra, C, Arrowsmith, C.H, Edwards, A, Oppermann, U. | | Deposit date: | 2014-08-28 | | Release date: | 2014-09-24 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.862 Å) | | Cite: | 1.86 A Structure of Human Spindlin-4 Protein in Complex with Histone H3K4Me3 Peptide
To be Published
|
|
3ZLI
 | | Crystal structure of JmjC domain of human histone demethylase UTY | | Descriptor: | 1,2-ETHANEDIOL, 2-OXOGLUTARIC ACID, FE (II) ION, ... | | Authors: | Vollmar, M, Gileadi, C, Shrestha, L, Goubin, S, Johansson, C, Krojer, T, Raynor, J.W, Bradley, A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2013-01-31 | | Release date: | 2013-02-27 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Human Uty(Kdm6C) is a Male-Specific Nepsilon-Methyl Lysyl Demethylase.
J.Biol.Chem., 289, 2014
|
|
3ZPO
 | | Crystal structure of JmjC domain of human histone demethylase UTY with bound GSK J1 | | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propanoic acid, FE (II) ION, ... | | Authors: | Vollmar, M, Gileadi, C, Shrestha, L, Goubin, S, Johansson, C, Krojer, T, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2013-02-28 | | Release date: | 2013-05-29 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Human Uty(Kdm6C) is a Male-Specific Nepislon-Methyl Lysyl Demethylase.
J.Biol.Chem., 289, 2014
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
3ZYW
 | | Crystal structure of the first glutaredoxin domain of human glutaredoxin 3 (GLRX3) | | Descriptor: | 1,2-ETHANEDIOL, GLUTAREDOXIN-3 | | Authors: | Vollmar, M, Johansson, C, Cocking, R, Krojer, T, Muniz, J.R.C, Kavanagh, K.L, von Delft, F, Bountra, C, Arrowsmith, C.H, Weigelt, J, Edwards, A, Oppermann, U. | | Deposit date: | 2011-08-29 | | Release date: | 2012-02-29 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Crystal Structure of the First Glutaredoxin Domain of Human Glutaredoxin 3 (Glrx3)
To be Published
|
|
6I8Y
 | | Crystal structure of Spindlin1 in complex with the Methyltransferase inhibitor A366 | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,2-ETHANEDIOL, 5'-methoxy-6'-[3-(pyrrolidin-1-yl)propoxy]spiro[cyclobutane-1,3'-indol]-2'-amine, ... | | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Shrestha, L, Sorrell, F.J, Krojer, T, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U.C.T. | | Deposit date: | 2018-11-21 | | Release date: | 2018-12-26 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.52 Å) | | Cite: | A Chemical Probe for Tudor Domain Protein Spindlin1 to Investigate Chromatin Function.
J.Med.Chem., 62, 2019
|
|
3BYI
 | | Crystal structure of human Rho GTPase activating protein 15 (ARHGAP15) | | Descriptor: | Rho GTPase activating protein 15 | | Authors: | Shrestha, L, Tickle, J, Elkins, J, Burgess-Brown, N, Johansson, C, Papagrigoriou, E, Kavanagh, K, Pike, A.C.W, Ugochukwu, E, Uppenberg, J, von Delft, F, Arrowsmith, C.H, Edwards, A.M, Weigelt, J, Doyle, D, Structural Genomics Consortium (SGC) | | Deposit date: | 2008-01-16 | | Release date: | 2008-02-26 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Crystal Structure of Human Rho GTPase Activating Protein 15 (ARHGAP15).
To be Published
|
|
3UIW
 | | Zebrafish Grx2 (APO) | | Descriptor: | GLUTATHIONE, Glutaredoxin 2, SULFATE ION | | Authors: | McDonough, M.A, Johansson, C. | | Deposit date: | 2011-11-06 | | Release date: | 2013-03-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.601 Å) | | Cite: | A New Mode of Iron-sulfur Cluster Coordination in Glutaredoxins is Crucial for Axonogenesis
To be Published
|
|
6YDV
 | | Crystal Structure of the Jmjc Domain of Human JMJD1B in complex with FM001511a from the DSPL fragment library | | Descriptor: | CHLORIDE ION, JMJD1B protein, MANGANESE (II) ION, ... | | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2020-03-21 | | Release date: | 2020-05-06 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Crystal Structure of the Jmjc Domain of Human JMJD1B in complex with FM001511a from the DSPL fragment library
To Be Published
|
|
5A3N
 | | Crystal structure of human PLU-1 (JARID1B) in complex with KDOAM25a | | Descriptor: | 1,2-ETHANEDIOL, 2-[[[2-[2-(dimethylamino)ethyl-ethyl-amino]-2-oxidanylidene-ethyl]amino]methyl]pyridine-4-carboxamide, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Nuzzi, A, Ruda, G.F, Kopec, J, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Brennan, P, Oppermann, U. | | Deposit date: | 2015-06-02 | | Release date: | 2015-07-08 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Potent and Selective KDM5 Inhibitor Stops Cellular Demethylation of H3K4me3 at Transcription Start Sites and Proliferation of MM1S Myeloma Cells.
Cell Chem Biol, 24, 2017
|
|
5F5I
 | | Crystal Structure of human JMJD2A complexed with KDOOA011340 | | Descriptor: | 2-[[(phenylmethyl)amino]methyl]pyridine-4-carboxylic acid, Lysine-specific demethylase 4A, NICKEL (II) ION, ... | | Authors: | Krojer, T, Vollmar, M, Crawley, L, Szykowska, A, Gileadi, C, Johansson, C, England, K, Yang, H, Burgess-Brown, N, Brennan, P, Bountra, C, Arrowsmith, C.H, Edwards, A, Oppermann, U, von Delft, F, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-12-04 | | Release date: | 2015-12-30 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | 8-Substituted Pyrido[3,4-d]pyrimidin-4(3H)-one Derivatives As Potent, Cell Permeable, KDM4 (JMJD2) and KDM5 (JARID1) Histone Lysine Demethylase Inhibitors.
J.Med.Chem., 59, 2016
|
|
3P1M
 | | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster | | Descriptor: | Adrenodoxin, mitochondrial, CITRATE ANION, ... | | Authors: | Chaikuad, A, Johansson, C, Krojer, T, Yue, W.W, Phillips, C, Bray, J.E, Pike, A.C.W, Muniz, J.R.C, Vollmar, M, Weigelt, J, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Kavanagh, K, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-09-30 | | Release date: | 2010-11-03 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.54 Å) | | Cite: | Crystal structure of human ferredoxin-1 (FDX1) in complex with iron-sulfur cluster
To be Published
|
|
6Q94
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase (S156D) in complex with GDP-Man | | Descriptor: | 1,2-ETHANEDIOL, GDP-mannose 4,6 dehydratase, GUANOSINE-5'-DIPHOSPHATE-ALPHA-D-MANNOSE, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-12-17 | | Release date: | 2019-04-24 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
3OP3
 | | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens | | Descriptor: | M-phase inducer phosphatase 3, SULFATE ION | | Authors: | Kim, Y, Weger, A, Hatzos, C, Savitsky, P, Johansson, C, Ball, L, Barr, A, Vollmar, M, Muniz, J, Weigelt, J, Arrowsmith, C.H, Edwards, A, Bountra, C, Gileadi, O, von Delft, F, Knapp, S, Joachimiak, A, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-08-31 | | Release date: | 2010-09-29 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | Crystal Structure of Cell Division Cycle 25C Protein Isoform A from Homo sapiens
TO BE PUBLISHED
|
|
5A1H
 | | Crystal structure of human Spindlin3 | | Descriptor: | SPINDLIN-3 | | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Shrestha, L, Tallon, R, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2015-04-30 | | Release date: | 2015-06-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Human Spindlin3
To be Published
|
|
5A1L
 | | Crystal structure of JmjC domain of human histone demethylase UTY with S21056a | | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propan-1-ol, FE (II) ION, ... | | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Krojer, T, Tumber, A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Brennan, P, Oppermann, U. | | Deposit date: | 2015-05-01 | | Release date: | 2015-06-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Jmjc Domain of Human Histone Demethylase Uty with S21056A
To be Published
|
|
1ZSY
 | | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63) | | Descriptor: | GLYCEROL, MITOCHONDRIAL 2-ENOYL THIOESTER REDUCTASE, SULFATE ION | | Authors: | Lukacik, P, Shafqat, N, Kavanagh, K.L, Johansson, C, Smee, C, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-05-25 | | Release date: | 2005-06-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63)
To be Published
|
|
2C46
 | | CRYSTAL STRUCTURE OF THE HUMAN RNA guanylyltransferase and 5'- phosphatase | | Descriptor: | MRNA CAPPING ENZYME | | Authors: | Debreczeni, J, Johansson, C, Longman, E, Gileadi, O, SavitskySmee, P, Smee, C, Bunkoczi, G, Ugochukwu, E, von Delft, F, Sundstrom, M, Weigelt, J, Arrowsmith, C, Edwards, A, Knapp, S. | | Deposit date: | 2005-10-15 | | Release date: | 2005-11-01 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystal Structure of the Human RNA Guanylyltransferase and 5'-Phosphatase
To be Published
|
|
1QWB
 | |
2CLP
 | | Crystal structure of human aflatoxin B1 aldehyde reductase member 3 | | Descriptor: | AFLATOXIN B1 ALDEHYDE REDUCTASE MEMBER 3, CALCIUM ION, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | | Authors: | Debreczeni, J.E, Marsden, B.D, Johansson, C, Kavanagh, K, Guo, K, Smee, C, Gileadi, O, Turnbull, A, Papagrigoriou, E, von Delft, F, Edwards, A, Arrowsmith, C, Weigelt, J, Sundstrom, M, Oppermann, U. | | Deposit date: | 2006-04-28 | | Release date: | 2006-05-12 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal Structure of Human Aflatoxin B1 Aldehyde Reductase Member 3
To be Published
|
|
1ZSV
 | | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase | | Descriptor: | CHLORIDE ION, NADP-dependent leukotriene B4 12-hydroxydehydrogenase | | Authors: | Turnbull, A.P, Johansson, C, Savitsky, P, Guo, K, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-05-25 | | Release date: | 2005-06-21 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase
To be Published
|
|
2CFY
 | | Crystal structure of human thioredoxin reductase 1 | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, THIOREDOXIN REDUCTASE 1 | | Authors: | Debreczeni, J.E, Johansson, C, Kavanagh, K, Savitsky, P, Sundstrom, M, Arrowsmith, C, Weigelt, J, Edwards, A, von Delft, F, Oppermann, U. | | Deposit date: | 2006-02-26 | | Release date: | 2006-03-09 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal Structure of Human Thioredoxin Reductase 1
To be Published
|
|
