4IHV

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Experimental procedure

Experimental method	SINGLE WAVELENGTH
Source type	SYNCHROTRON
Source details	APS BEAMLINE 24-ID-C
Synchrotron site	APS
Beamline	24-ID-C
Temperature [K]	100
Detector technology	CCD
Collection date	2011-07-24
Detector	ADSC QUANTUM 315
Wavelength(s)	0.92017
Spacegroup name	P 21 21 21
Unit cell lengths	42.790, 89.390, 154.150
Unit cell angles	90.00, 90.00, 90.00

Refinement procedure

Resolution	42.927 - 2.716
R-factor	0.221
Rwork	0.217
R-free	0.25750
Structure solution method	MOLECULAR REPLACEMENT
Starting model (for MR)	3iv5
RMSD bond length	0.008
RMSD bond angle	1.491
Data reduction software	XDS
Data scaling software	XSCALE
Phasing software	PHASER (2.5.1)
Refinement software	PHENIX (1.8_1069)

Data quality characteristics

	Overall	Inner shell	Outer shell
Low resolution limit [Å]	100.000		2.790
High resolution limit [Å]	2.716	12.150	2.716
Rmerge	0.082	0.034	0.880
Number of reflections	16603	219	1173
<I/σ(I)>	16.06	31.91	2.38
Completeness [%]	99.6	94	97.5
Redundancy	6.99

Crystallization Conditions

crystal ID	method	pH	temperature	details
1	VAPOR DIFFUSION, HANGING DROP	8.5	277	0.2 M sodium citrate, 0.1 M Tris-HCl, pH 8.5, 36% PEG400, VAPOR DIFFUSION, HANGING DROP, temperature 277K