Author results

4IHV
  • Download 4ihv
  • View 4ihv
Molmil generated image of 4ihv
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Descriptor:DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2012-12-19
Release date:2013-05-01
Last modified:2013-07-31
Method:X-RAY DIFFRACTION (2.716 Å)
Cite:Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
Nucleic Acids Res., 41, 2013
4IHW
  • Download 4ihw
  • View 4ihw
Molmil generated image of 4ihw
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
Descriptor:DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2012-12-19
Release date:2013-05-01
Last modified:2013-07-31
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
Nucleic Acids Res., 41, 2013
4IHX
  • Download 4ihx
  • View 4ihx
Molmil generated image of 4ihx
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
Descriptor:DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2012-12-19
Release date:2013-05-01
Last modified:2013-07-31
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
Nucleic Acids Res., 41, 2013
4IHY
  • Download 4ihy
  • View 4ihy
Molmil generated image of 4ihy
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)
Descriptor:DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2012-12-19
Release date:2013-05-01
Last modified:2013-07-31
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
Nucleic Acids Res., 41, 2013
5DS9
  • Download 5ds9
  • View 5ds9
Molmil generated image of 5ds9
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-09-17
Release date:2016-07-27
Method:X-RAY DIFFRACTION (2.561 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5DTD
  • Download 5dtd
  • View 5dtd
Molmil generated image of 5dtd
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-09-17
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.642 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3L
  • Download 5e3l
  • View 5e3l
Molmil generated image of 5e3l
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-23
Method:X-RAY DIFFRACTION (2.66 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3N
  • Download 5e3n
  • View 5e3n
Molmil generated image of 5e3n
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.66 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3O
  • Download 5e3o
  • View 5e3o
Molmil generated image of 5e3o
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.78 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
6P0S
  • Download 6p0s
  • View 6p0s
Molmil generated image of 6p0s
CRYSTAL STRUCTURE OF TERNARY DNA COMPLEX "FX2" CONTAINING E. COLI FIS AND PHAGE LAMBDA XIS
Descriptor:DNA-binding protein Fis, DNA (27-MER), FX1-2, ...
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2019-05-17
Release date:2019-06-19
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structure of the Fis-Xis-DNA ternary complex on the native attR site, FX2
to be published
6P0T
  • Download 6p0t
  • View 6p0t
Molmil generated image of 6p0t
CRYSTAL STRUCTURE OF TERNARY DNA COMPLEX "FX(1-2)-1XIS" CONTAINING E. COLI FIS AND PHAGE LAMBDA XIS
Descriptor:DNA-binding protein Fis, DNA (27-MER), FX1-2, ...
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2019-05-17
Release date:2019-06-19
Method:X-RAY DIFFRACTION (3.603 Å)
Cite:Crystal structure of the Fis-Xis-DNA ternary complex on the non-native site, FX1-2
to be published
6P0U
  • Download 6p0u
  • View 6p0u
Molmil generated image of 6p0u
CRYSTAL STRUCTURE OF TERNARY DNA COMPLEX " FX(1-2)-2XIS" CONTAINING E. COLI FIS AND PHAGE LAMBDA XIS
Descriptor:DNA-binding protein Fis, DNA (27-MER), FX1-2, ...
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2019-05-17
Release date:2019-06-19
Method:X-RAY DIFFRACTION (3.3 Å)
Cite:Crystal structure of the Fis-Xis-DNA ternary complex on the non-native site, FX1-2
to be published
5E3M
  • Download 5e3m
  • View 5e3m
Molmil generated image of 5e3m
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.886 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
6DGC
  • Download 6dgc
  • View 6dgc
Molmil generated image of 6dgc
CRYSTAL STRUCTURE OF THE C-TERMINAL CATALYTIC DOMAIN OF ISC1926 TNPA, AN IS607-LIKE SERINE RECOMBINASE
Descriptor:ISC1926 TnpA C-terminal catalytic domain
Authors:Hancock, S.P., Kumar, P., Cascio, D., Johnson, R.C.
Deposit date:2018-05-17
Release date:2018-07-18
Last modified:2019-04-03
Method:X-RAY DIFFRACTION (2.92 Å)
Cite:Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
6DGB
  • Download 6dgb
  • View 6dgb
Molmil generated image of 6dgb
CRYSTAL STRUCTURE OF THE C-TERMINAL CATALYTIC DOMAIN OF IS1535 TNPA, AN IS607-LIKE SERINE RECOMBINASE
Descriptor:IS607 family transposase IS1535
Authors:Chen, W.Y., Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2018-05-17
Release date:2018-07-18
Last modified:2019-04-03
Method:X-RAY DIFFRACTION (2.52 Å)
Cite:Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018