1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
4WU8
| Structure of trPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
8YTI
| Crystal Structure of Nucleosome-H1x Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Padavattan, S, Davey, C.A. | Deposit date: | 2024-03-26 | Release date: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Linker Histones Associate Heterogeneously with Nucleosomes in the Condensed State To Be Published
|
|
8QKT
| |
4KGC
| Nucleosome Core Particle Containing (ETA6-P-CYMENE)-(1, 2-ETHYLENEDIAMINE)-RUTHENIUM | Descriptor: | (ethane-1,2-diamine-kappa~2~N,N')[(1,2,3,4,5,6-eta)-1-methyl-4-(propan-2-yl)cyclohexane-1,2,3,4,5,6-hexayl]ruthenium, DNA (145-mer), Histone H2A, ... | Authors: | Adhireksan, Z, Davey, C.A. | Deposit date: | 2013-04-29 | Release date: | 2014-03-26 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.69 Å) | Cite: | Ligand substitutions between ruthenium-cymene compounds can control protein versus DNA targeting and anticancer activity Nat Commun, 5, 2014
|
|
7COW
| 353 bp di-nucleosome harboring cohesive DNA termini with linker histone H1.0 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (353-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2020-08-05 | Release date: | 2021-08-11 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
4WU9
| Structure of cisPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
3B6F
| |
3B6G
| |
3KUY
| |
8Q3X
| Structure of Nucleosome Core with a Bound Metallopeptide Conjugate (Kaposi Sarcoma Associated Herpesvirus LANA Peptide-Au[I] Compound) | Descriptor: | 4-diphenylphosphanylbenzoic acid, DNA (145-MER), GOLD ION, ... | Authors: | De Falco, L, Batchelor, L.K, Dyson, P.J, Davey, C.A. | Deposit date: | 2023-08-04 | Release date: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.301 Å) | Cite: | Viral peptide conjugates for metal-warhead delivery to chromatin. Rsc Adv, 14, 2024
|
|
8Q3E
| High Resolution Structure of Nucleosome Core with Bound Foamy Virus GAG Peptide | Descriptor: | DNA (145-MER), GLY-GLY-TYR-ASN-LEU-ARG-PRO-ARG-THR-TYR-GLN-PRO-GLN-ARG-TYR-GLY-GLY-GLY, Histone H2A type 1-B/E, ... | Authors: | De Falco, L, Batchelor, L.K, Dyson, P.J, Davey, C.A. | Deposit date: | 2023-08-04 | Release date: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.174 Å) | Cite: | Viral peptide conjugates for metal-warhead delivery to chromatin. Rsc Adv, 14, 2024
|
|
8Q3M
| Structure of Nucleosome Core with a Bound Kaposi Sarcoma Associated Herpesvirus LANA Peptide Having a Methionine to Ornithine Substitution | Descriptor: | DNA (145-MER), Histone H2A type 1-B/E, Histone H2B type 1-K, ... | Authors: | De Falco, L, Batchelor, L.K, Dyson, P.J, Davey, C.A. | Deposit date: | 2023-08-04 | Release date: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.503 Å) | Cite: | Viral peptide conjugates for metal-warhead delivery to chromatin. Rsc Adv, 14, 2024
|
|
8Q36
| Structure of Nucleosome Core with a Bound Metallopeptide Conjugate (Foamy Virus GAG Peptide-Au[I] Compound) | Descriptor: | DNA (145-MER), GAG structural protein, Histone H2A type 1-B/E, ... | Authors: | De Falco, L, Batchelor, L.K, Dyson, P.J, Davey, C.A. | Deposit date: | 2023-08-03 | Release date: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.604 Å) | Cite: | Viral peptide conjugates for metal-warhead delivery to chromatin. Rsc Adv, 14, 2024
|
|
7XVM
| Crystal Structure of Nucleosome-H5 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XX5
| Crystal Structure of Nucleosome-H1.3 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.3, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.19 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XX6
| Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.0, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.39 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
3UTB
| Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3UT9
| Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3UTA
| Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
5XF3
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,R-configuration) | Descriptor: | (1R,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF5
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,S-configuration) | Descriptor: | (1S,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.82 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF6
| Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|